ID: 985866112

View in Genome Browser
Species Human (GRCh38)
Location 5:2515798-2515820
Sequence CGCTCTGCGGCTCGGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985866098_985866112 27 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866112 5:2515798-2515820 CGCTCTGCGGCTCGGGTCCCAGG No data
985866102_985866112 16 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866112 5:2515798-2515820 CGCTCTGCGGCTCGGGTCCCAGG No data
985866097_985866112 28 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866112 5:2515798-2515820 CGCTCTGCGGCTCGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985866112 Original CRISPR CGCTCTGCGGCTCGGGTCCC AGG Intergenic