ID: 985870374

View in Genome Browser
Species Human (GRCh38)
Location 5:2549551-2549573
Sequence CCGTGCCAGTGTGCCATCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985870368_985870374 -6 Left 985870368 5:2549534-2549556 CCAGGATCCACCGCCAGCCGTGC No data
Right 985870374 5:2549551-2549573 CCGTGCCAGTGTGCCATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985870374 Original CRISPR CCGTGCCAGTGTGCCATCTT GGG Intergenic
No off target data available for this crispr