ID: 985870959

View in Genome Browser
Species Human (GRCh38)
Location 5:2556523-2556545
Sequence GCCCCATCTAGAGTGCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985870953_985870959 10 Left 985870953 5:2556490-2556512 CCCTGGCTCCATGTTGAGGACTT No data
Right 985870959 5:2556523-2556545 GCCCCATCTAGAGTGCAGACGGG No data
985870956_985870959 2 Left 985870956 5:2556498-2556520 CCATGTTGAGGACTTGTGCTGGG No data
Right 985870959 5:2556523-2556545 GCCCCATCTAGAGTGCAGACGGG No data
985870954_985870959 9 Left 985870954 5:2556491-2556513 CCTGGCTCCATGTTGAGGACTTG No data
Right 985870959 5:2556523-2556545 GCCCCATCTAGAGTGCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985870959 Original CRISPR GCCCCATCTAGAGTGCAGAC GGG Intergenic
No off target data available for this crispr