ID: 985873220

View in Genome Browser
Species Human (GRCh38)
Location 5:2575456-2575478
Sequence TTGTAAGCTCAGGTGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985873220_985873224 4 Left 985873220 5:2575456-2575478 CCCAGCTTCACCTGAGCTTACAA No data
Right 985873224 5:2575483-2575505 TTCCCCCTCACCCAGCAGGAAGG No data
985873220_985873223 0 Left 985873220 5:2575456-2575478 CCCAGCTTCACCTGAGCTTACAA No data
Right 985873223 5:2575479-2575501 AACATTCCCCCTCACCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985873220 Original CRISPR TTGTAAGCTCAGGTGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr