ID: 985876494

View in Genome Browser
Species Human (GRCh38)
Location 5:2602593-2602615
Sequence GCAGCTGTGCTAGCAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985876494_985876496 15 Left 985876494 5:2602593-2602615 CCAGGAACTGCTAGCACAGCTGC No data
Right 985876496 5:2602631-2602653 GTCTGTCCCTAAAGAGGATGTGG No data
985876494_985876500 27 Left 985876494 5:2602593-2602615 CCAGGAACTGCTAGCACAGCTGC No data
Right 985876500 5:2602643-2602665 AGAGGATGTGGGCGTCCAGATGG No data
985876494_985876495 9 Left 985876494 5:2602593-2602615 CCAGGAACTGCTAGCACAGCTGC No data
Right 985876495 5:2602625-2602647 CTATCAGTCTGTCCCTAAAGAGG No data
985876494_985876497 16 Left 985876494 5:2602593-2602615 CCAGGAACTGCTAGCACAGCTGC No data
Right 985876497 5:2602632-2602654 TCTGTCCCTAAAGAGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985876494 Original CRISPR GCAGCTGTGCTAGCAGTTCC TGG (reversed) Intergenic
No off target data available for this crispr