ID: 985876929

View in Genome Browser
Species Human (GRCh38)
Location 5:2606994-2607016
Sequence CACACCAGGCAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985876929_985876936 14 Left 985876929 5:2606994-2607016 CCCTGCTCCATCTGCCTGGTGTG No data
Right 985876936 5:2607031-2607053 CACAAACTCTGACCTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985876929 Original CRISPR CACACCAGGCAGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr