ID: 985879679

View in Genome Browser
Species Human (GRCh38)
Location 5:2628765-2628787
Sequence TGCAGGGCGTGGAGTGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985879679_985879686 10 Left 985879679 5:2628765-2628787 CCCCTTGCACTCCACGCCCTGCA No data
Right 985879686 5:2628798-2628820 CTGTCATCACCTCCTGCTACAGG No data
985879679_985879687 11 Left 985879679 5:2628765-2628787 CCCCTTGCACTCCACGCCCTGCA No data
Right 985879687 5:2628799-2628821 TGTCATCACCTCCTGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985879679 Original CRISPR TGCAGGGCGTGGAGTGCAAG GGG (reversed) Intergenic
No off target data available for this crispr