ID: 985880092

View in Genome Browser
Species Human (GRCh38)
Location 5:2632881-2632903
Sequence GTAAGAATCCTGCTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985880090_985880092 0 Left 985880090 5:2632858-2632880 CCGAGTCTGTGGACACTTTCCTA No data
Right 985880092 5:2632881-2632903 GTAAGAATCCTGCTTCTCACAGG No data
985880087_985880092 24 Left 985880087 5:2632834-2632856 CCATGTGAGGATCAGAGAACAGA No data
Right 985880092 5:2632881-2632903 GTAAGAATCCTGCTTCTCACAGG No data
985880089_985880092 1 Left 985880089 5:2632857-2632879 CCCGAGTCTGTGGACACTTTCCT No data
Right 985880092 5:2632881-2632903 GTAAGAATCCTGCTTCTCACAGG No data
985880084_985880092 29 Left 985880084 5:2632829-2632851 CCCTCCCATGTGAGGATCAGAGA No data
Right 985880092 5:2632881-2632903 GTAAGAATCCTGCTTCTCACAGG No data
985880086_985880092 25 Left 985880086 5:2632833-2632855 CCCATGTGAGGATCAGAGAACAG No data
Right 985880092 5:2632881-2632903 GTAAGAATCCTGCTTCTCACAGG No data
985880085_985880092 28 Left 985880085 5:2632830-2632852 CCTCCCATGTGAGGATCAGAGAA No data
Right 985880092 5:2632881-2632903 GTAAGAATCCTGCTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985880092 Original CRISPR GTAAGAATCCTGCTTCTCAC AGG Intergenic
No off target data available for this crispr