ID: 985882747

View in Genome Browser
Species Human (GRCh38)
Location 5:2652763-2652785
Sequence AATGTCAAGGAGAGCATAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985882747_985882752 -3 Left 985882747 5:2652763-2652785 CCCCCTATGCTCTCCTTGACATT No data
Right 985882752 5:2652783-2652805 ATTGCATTGCATAAGCTGAGTGG No data
985882747_985882756 26 Left 985882747 5:2652763-2652785 CCCCCTATGCTCTCCTTGACATT No data
Right 985882756 5:2652812-2652834 AGAGTGACCAGCCCAGGATGTGG No data
985882747_985882755 20 Left 985882747 5:2652763-2652785 CCCCCTATGCTCTCCTTGACATT No data
Right 985882755 5:2652806-2652828 GTGGAAAGAGTGACCAGCCCAGG No data
985882747_985882754 1 Left 985882747 5:2652763-2652785 CCCCCTATGCTCTCCTTGACATT No data
Right 985882754 5:2652787-2652809 CATTGCATAAGCTGAGTGGGTGG No data
985882747_985882753 -2 Left 985882747 5:2652763-2652785 CCCCCTATGCTCTCCTTGACATT No data
Right 985882753 5:2652784-2652806 TTGCATTGCATAAGCTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985882747 Original CRISPR AATGTCAAGGAGAGCATAGG GGG (reversed) Intergenic
No off target data available for this crispr