ID: 985882909

View in Genome Browser
Species Human (GRCh38)
Location 5:2654023-2654045
Sequence CCGGGTCCCCCTCGTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985882899_985882909 26 Left 985882899 5:2653974-2653996 CCATGTCTGGATGCAGGCTGAAT No data
Right 985882909 5:2654023-2654045 CCGGGTCCCCCTCGTCTTCCAGG No data
985882903_985882909 -5 Left 985882903 5:2654005-2654027 CCAGCTGCCCACGGACTCCCGGG No data
Right 985882909 5:2654023-2654045 CCGGGTCCCCCTCGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985882909 Original CRISPR CCGGGTCCCCCTCGTCTTCC AGG Intergenic
No off target data available for this crispr