ID: 985884759

View in Genome Browser
Species Human (GRCh38)
Location 5:2668868-2668890
Sequence GGCGGGGCCGAGGCCCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985884759_985884769 18 Left 985884759 5:2668868-2668890 CCTGACTGGGCCTCGGCCCCGCC No data
Right 985884769 5:2668909-2668931 ACAGCCTGCGGCCACTCTTGAGG No data
985884759_985884767 6 Left 985884759 5:2668868-2668890 CCTGACTGGGCCTCGGCCCCGCC No data
Right 985884767 5:2668897-2668919 CTGGATCCTGCTACAGCCTGCGG No data
985884759_985884771 20 Left 985884759 5:2668868-2668890 CCTGACTGGGCCTCGGCCCCGCC No data
Right 985884771 5:2668911-2668933 AGCCTGCGGCCACTCTTGAGGGG No data
985884759_985884770 19 Left 985884759 5:2668868-2668890 CCTGACTGGGCCTCGGCCCCGCC No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985884759 Original CRISPR GGCGGGGCCGAGGCCCAGTC AGG (reversed) Intergenic
No off target data available for this crispr