ID: 985884762

View in Genome Browser
Species Human (GRCh38)
Location 5:2668884-2668906
Sequence CAGGATCCAGAGGAGAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985884762_985884774 30 Left 985884762 5:2668884-2668906 CCCCGCCTCTCCTCTGGATCCTG No data
Right 985884774 5:2668937-2668959 ACGTTCGCCCAGAGTGCTGCTGG No data
985884762_985884769 2 Left 985884762 5:2668884-2668906 CCCCGCCTCTCCTCTGGATCCTG No data
Right 985884769 5:2668909-2668931 ACAGCCTGCGGCCACTCTTGAGG No data
985884762_985884767 -10 Left 985884762 5:2668884-2668906 CCCCGCCTCTCCTCTGGATCCTG No data
Right 985884767 5:2668897-2668919 CTGGATCCTGCTACAGCCTGCGG No data
985884762_985884770 3 Left 985884762 5:2668884-2668906 CCCCGCCTCTCCTCTGGATCCTG No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884762_985884771 4 Left 985884762 5:2668884-2668906 CCCCGCCTCTCCTCTGGATCCTG No data
Right 985884771 5:2668911-2668933 AGCCTGCGGCCACTCTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985884762 Original CRISPR CAGGATCCAGAGGAGAGGCG GGG (reversed) Intergenic
No off target data available for this crispr