ID: 985884763

View in Genome Browser
Species Human (GRCh38)
Location 5:2668885-2668907
Sequence GCAGGATCCAGAGGAGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985884763_985884769 1 Left 985884763 5:2668885-2668907 CCCGCCTCTCCTCTGGATCCTGC No data
Right 985884769 5:2668909-2668931 ACAGCCTGCGGCCACTCTTGAGG No data
985884763_985884774 29 Left 985884763 5:2668885-2668907 CCCGCCTCTCCTCTGGATCCTGC No data
Right 985884774 5:2668937-2668959 ACGTTCGCCCAGAGTGCTGCTGG No data
985884763_985884770 2 Left 985884763 5:2668885-2668907 CCCGCCTCTCCTCTGGATCCTGC No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884763_985884771 3 Left 985884763 5:2668885-2668907 CCCGCCTCTCCTCTGGATCCTGC No data
Right 985884771 5:2668911-2668933 AGCCTGCGGCCACTCTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985884763 Original CRISPR GCAGGATCCAGAGGAGAGGC GGG (reversed) Intergenic
No off target data available for this crispr