ID: 985884766

View in Genome Browser
Species Human (GRCh38)
Location 5:2668894-2668916
Sequence CAGGCTGTAGCAGGATCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985884766_985884774 20 Left 985884766 5:2668894-2668916 CCTCTGGATCCTGCTACAGCCTG No data
Right 985884774 5:2668937-2668959 ACGTTCGCCCAGAGTGCTGCTGG No data
985884766_985884769 -8 Left 985884766 5:2668894-2668916 CCTCTGGATCCTGCTACAGCCTG No data
Right 985884769 5:2668909-2668931 ACAGCCTGCGGCCACTCTTGAGG No data
985884766_985884770 -7 Left 985884766 5:2668894-2668916 CCTCTGGATCCTGCTACAGCCTG No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884766_985884777 29 Left 985884766 5:2668894-2668916 CCTCTGGATCCTGCTACAGCCTG No data
Right 985884777 5:2668946-2668968 CAGAGTGCTGCTGGCTTCCCTGG No data
985884766_985884771 -6 Left 985884766 5:2668894-2668916 CCTCTGGATCCTGCTACAGCCTG No data
Right 985884771 5:2668911-2668933 AGCCTGCGGCCACTCTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985884766 Original CRISPR CAGGCTGTAGCAGGATCCAG AGG (reversed) Intergenic
No off target data available for this crispr