ID: 985884770

View in Genome Browser
Species Human (GRCh38)
Location 5:2668910-2668932
Sequence CAGCCTGCGGCCACTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985884763_985884770 2 Left 985884763 5:2668885-2668907 CCCGCCTCTCCTCTGGATCCTGC No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884760_985884770 9 Left 985884760 5:2668878-2668900 CCTCGGCCCCGCCTCTCCTCTGG No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884765_985884770 -2 Left 985884765 5:2668889-2668911 CCTCTCCTCTGGATCCTGCTACA No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884758_985884770 20 Left 985884758 5:2668867-2668889 CCCTGACTGGGCCTCGGCCCCGC No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884762_985884770 3 Left 985884762 5:2668884-2668906 CCCCGCCTCTCCTCTGGATCCTG No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884759_985884770 19 Left 985884759 5:2668868-2668890 CCTGACTGGGCCTCGGCCCCGCC No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884764_985884770 1 Left 985884764 5:2668886-2668908 CCGCCTCTCCTCTGGATCCTGCT No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884756_985884770 30 Left 985884756 5:2668857-2668879 CCTGCAGAGACCCTGACTGGGCC No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data
985884766_985884770 -7 Left 985884766 5:2668894-2668916 CCTCTGGATCCTGCTACAGCCTG No data
Right 985884770 5:2668910-2668932 CAGCCTGCGGCCACTCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985884770 Original CRISPR CAGCCTGCGGCCACTCTTGA GGG Intergenic
No off target data available for this crispr