ID: 985884891

View in Genome Browser
Species Human (GRCh38)
Location 5:2670153-2670175
Sequence CAGTGGAAGGGGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985884891_985884904 6 Left 985884891 5:2670153-2670175 CCCTCCAGCCTCCCCTTCCACTG No data
Right 985884904 5:2670182-2670204 GGCCTGCTCTGCACCTCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985884891 Original CRISPR CAGTGGAAGGGGAGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr