ID: 985885498

View in Genome Browser
Species Human (GRCh38)
Location 5:2674478-2674500
Sequence CTGTATCCACCCATGGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985885498_985885504 17 Left 985885498 5:2674478-2674500 CCCAAGACCATGGGTGGATACAG No data
Right 985885504 5:2674518-2674540 CTGTACTCAATTAATGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985885498 Original CRISPR CTGTATCCACCCATGGTCTT GGG (reversed) Intergenic
No off target data available for this crispr