ID: 985886566

View in Genome Browser
Species Human (GRCh38)
Location 5:2684772-2684794
Sequence CCCGGCACCCATGAGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985886566_985886585 28 Left 985886566 5:2684772-2684794 CCCCACAACTCATGGGTGCCGGG No data
Right 985886585 5:2684823-2684845 CCATCTTCCCCAACACTCATGGG No data
985886566_985886573 -1 Left 985886566 5:2684772-2684794 CCCCACAACTCATGGGTGCCGGG No data
Right 985886573 5:2684794-2684816 GGGTTGTCAGCTTCCCCGCCCGG No data
985886566_985886587 30 Left 985886566 5:2684772-2684794 CCCCACAACTCATGGGTGCCGGG No data
Right 985886587 5:2684825-2684847 ATCTTCCCCAACACTCATGGGGG No data
985886566_985886583 27 Left 985886566 5:2684772-2684794 CCCCACAACTCATGGGTGCCGGG No data
Right 985886583 5:2684822-2684844 ACCATCTTCCCCAACACTCATGG No data
985886566_985886586 29 Left 985886566 5:2684772-2684794 CCCCACAACTCATGGGTGCCGGG No data
Right 985886586 5:2684824-2684846 CATCTTCCCCAACACTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985886566 Original CRISPR CCCGGCACCCATGAGTTGTG GGG (reversed) Intergenic
No off target data available for this crispr