ID: 985888658

View in Genome Browser
Species Human (GRCh38)
Location 5:2699458-2699480
Sequence TCTGGGACCCCGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985888652_985888658 0 Left 985888652 5:2699435-2699457 CCTGGACACAGAGGATGGACTTG No data
Right 985888658 5:2699458-2699480 TCTGGGACCCCGAGGGAGCAGGG No data
985888649_985888658 15 Left 985888649 5:2699420-2699442 CCATGTCAGAGGATGCCTGGACA No data
Right 985888658 5:2699458-2699480 TCTGGGACCCCGAGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985888658 Original CRISPR TCTGGGACCCCGAGGGAGCA GGG Intergenic
No off target data available for this crispr