ID: 985888862

View in Genome Browser
Species Human (GRCh38)
Location 5:2700420-2700442
Sequence GCCCGAAGGGCGGTGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985888862_985888871 9 Left 985888862 5:2700420-2700442 CCTGTGGCCACCGCCCTTCGGGC No data
Right 985888871 5:2700452-2700474 GCCCCAGCAATCCTCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985888862 Original CRISPR GCCCGAAGGGCGGTGGCCAC AGG (reversed) Intergenic
No off target data available for this crispr