ID: 985893574

View in Genome Browser
Species Human (GRCh38)
Location 5:2735811-2735833
Sequence CACCAGCAACTAGTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985893568_985893574 16 Left 985893568 5:2735772-2735794 CCAGGCCCCATGATCCTGGTGAA No data
Right 985893574 5:2735811-2735833 CACCAGCAACTAGTGGAGCTTGG No data
985893572_985893574 2 Left 985893572 5:2735786-2735808 CCTGGTGAACTGCTGATAAGATG No data
Right 985893574 5:2735811-2735833 CACCAGCAACTAGTGGAGCTTGG No data
985893570_985893574 10 Left 985893570 5:2735778-2735800 CCCATGATCCTGGTGAACTGCTG No data
Right 985893574 5:2735811-2735833 CACCAGCAACTAGTGGAGCTTGG No data
985893571_985893574 9 Left 985893571 5:2735779-2735801 CCATGATCCTGGTGAACTGCTGA No data
Right 985893574 5:2735811-2735833 CACCAGCAACTAGTGGAGCTTGG No data
985893569_985893574 11 Left 985893569 5:2735777-2735799 CCCCATGATCCTGGTGAACTGCT No data
Right 985893574 5:2735811-2735833 CACCAGCAACTAGTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985893574 Original CRISPR CACCAGCAACTAGTGGAGCT TGG Intergenic
No off target data available for this crispr