ID: 985894205

View in Genome Browser
Species Human (GRCh38)
Location 5:2739378-2739400
Sequence GGCGCTGGGGCCGCAGATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985894197_985894205 -9 Left 985894197 5:2739364-2739386 CCACTGCCCGCCTGGGCGCTGGG No data
Right 985894205 5:2739378-2739400 GGCGCTGGGGCCGCAGATCGGGG No data
985894191_985894205 10 Left 985894191 5:2739345-2739367 CCTGGGGTCCCGTCGGTGTCCAC No data
Right 985894205 5:2739378-2739400 GGCGCTGGGGCCGCAGATCGGGG No data
985894189_985894205 22 Left 985894189 5:2739333-2739355 CCGGGGGTACGGCCTGGGGTCCC No data
Right 985894205 5:2739378-2739400 GGCGCTGGGGCCGCAGATCGGGG No data
985894193_985894205 1 Left 985894193 5:2739354-2739376 CCGTCGGTGTCCACTGCCCGCCT No data
Right 985894205 5:2739378-2739400 GGCGCTGGGGCCGCAGATCGGGG No data
985894192_985894205 2 Left 985894192 5:2739353-2739375 CCCGTCGGTGTCCACTGCCCGCC No data
Right 985894205 5:2739378-2739400 GGCGCTGGGGCCGCAGATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985894205 Original CRISPR GGCGCTGGGGCCGCAGATCG GGG Intergenic
No off target data available for this crispr