ID: 985894345

View in Genome Browser
Species Human (GRCh38)
Location 5:2739875-2739897
Sequence GAACCCGATGGGTCCCGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985894342_985894345 -5 Left 985894342 5:2739857-2739879 CCGGGGTCAGGGCGGGAGGAACC No data
Right 985894345 5:2739875-2739897 GAACCCGATGGGTCCCGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985894345 Original CRISPR GAACCCGATGGGTCCCGCTG CGG Intergenic
No off target data available for this crispr