ID: 985895512

View in Genome Browser
Species Human (GRCh38)
Location 5:2748405-2748427
Sequence GGCCAGCGACGCGGGCAAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985895512_985895519 -2 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895519 5:2748426-2748448 CCGCCTTTGGCGCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
985895512_985895517 -10 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895517 5:2748418-2748440 GTCGCTGGCCGCCTTTGGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 46
985895512_985895520 -1 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895520 5:2748427-2748449 CGCCTTTGGCGCGGTGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
985895512_985895522 8 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895522 5:2748436-2748458 CGCGGTGTGCAGGGCCTCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 116
985895512_985895524 10 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895524 5:2748438-2748460 CGGTGTGCAGGGCCTCGCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 155
985895512_985895523 9 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895523 5:2748437-2748459 GCGGTGTGCAGGGCCTCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 174
985895512_985895525 11 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895525 5:2748439-2748461 GGTGTGCAGGGCCTCGCCGGGGG 0: 1
1: 0
2: 1
3: 7
4: 180
985895512_985895526 17 Left 985895512 5:2748405-2748427 CCGCCTTGCCCGCGTCGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 985895526 5:2748445-2748467 CAGGGCCTCGCCGGGGGCCGCGG 0: 1
1: 0
2: 3
3: 79
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985895512 Original CRISPR GGCCAGCGACGCGGGCAAGG CGG (reversed) Exonic