ID: 985895918

View in Genome Browser
Species Human (GRCh38)
Location 5:2750077-2750099
Sequence CTGTGTGCGCGCACGTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985895918_985895925 29 Left 985895918 5:2750077-2750099 CCCTTGCACGTGCGCGCACACAG 0: 1
1: 0
2: 1
3: 11
4: 91
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256
985895918_985895924 22 Left 985895918 5:2750077-2750099 CCCTTGCACGTGCGCGCACACAG 0: 1
1: 0
2: 1
3: 11
4: 91
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985895918 Original CRISPR CTGTGTGCGCGCACGTGCAA GGG (reversed) Intronic
905110348 1:35590238-35590260 ATGTGTGCATGCATGTGCAATGG + Intronic
915642427 1:157239113-157239135 CTGTGTGTGCTCAGTTGCAAAGG - Intergenic
915942212 1:160125538-160125560 CTGTGTGTGCGCATGCGTAAGGG - Intronic
921314975 1:213881895-213881917 TTGTGTGTGTGCATGTGCAAGGG - Intergenic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1064847344 10:19670055-19670077 GTGTGTGTGTGCACGTGCGAGGG - Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1074245485 10:111687049-111687071 GTGTGTGTGTGCACGTGCACAGG + Intergenic
1075914472 10:126155594-126155616 CTGGGTGCACACACTTGCAAAGG + Intronic
1076420493 10:130327952-130327974 CTGTGTGTGTGCACATGCACTGG + Intergenic
1078066607 11:8082903-8082925 CTGTATGTGCGCACGTGTGAGGG - Intronic
1078188731 11:9074408-9074430 GTGTGTGTGTGCGCGTGCAAGGG + Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1089212837 11:116817651-116817673 CTGTGTCCTCGCACGTGGAAGGG + Intergenic
1091207262 11:133830401-133830423 AAGTGTGTGCACACGTGCAAAGG + Intergenic
1092386456 12:8039037-8039059 CTGTGGGCGGGAGCGTGCAAGGG + Intronic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1100854397 12:98746065-98746087 CTGTGTGCTCACAAGGGCAAGGG - Intronic
1101525444 12:105524240-105524262 CTGTGGGCCGGCAGGTGCAATGG + Intergenic
1102558171 12:113742544-113742566 CTCTGTGGGGGCACCTGCAAGGG + Intergenic
1103377750 12:120469795-120469817 CGGCCTGCGCGCACGCGCAATGG - Intergenic
1105209311 13:18248323-18248345 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1106757434 13:32837039-32837061 CTGTGTCCCCGCAGGTGAAAGGG + Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1117658752 14:57983067-57983089 CTCTGTCTGCCCACGTGCAATGG + Intergenic
1119649795 14:76375662-76375684 CTGTGTGCGCAAAAGTGCAAAGG - Intronic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1128767424 15:70259697-70259719 GTGTGTGCCCGCATGTGCACGGG + Intergenic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1131381598 15:91968707-91968729 CTGTGTGAGCACACGTGCGAAGG - Intronic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1137911526 16:52382901-52382923 GTGTGTGTGTGCACGTGCAAAGG - Intergenic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141676995 16:85523319-85523341 CTGTGTGTGCGTGCGTGCATGGG + Intergenic
1146885659 17:36469184-36469206 CTGTGTGCTCCCTCCTGCAAGGG - Intergenic
1147924859 17:43940048-43940070 GTGTGTACGCGCATGTGTAAAGG - Intergenic
1152320135 17:79604100-79604122 CTGTGTGTGCCCACGGGCAAAGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1161839585 19:6671265-6671287 GTGTGTGTGCGCACTTGCACGGG + Intergenic
925040401 2:728851-728873 CTGTGTGTGCGTGTGTGCAAGGG + Intergenic
937477179 2:122226115-122226137 CTGTGTGTGCGCACATGCACAGG + Intergenic
938461892 2:131502709-131502731 GTGTGCGCGTGCGCGTGCAATGG - Intergenic
1180023493 21:45144771-45144793 CTGTGTGCCAGCAAGTGGAAAGG - Intronic
1180766947 22:18350974-18350996 GTGTGTGTGTGCACGTGCACTGG + Intergenic
1180779367 22:18511405-18511427 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1180812082 22:18768725-18768747 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181198238 22:21202969-21202991 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181648046 22:24244284-24244306 GTGTGTGTGTGCACGTGCACTGG - Intronic
1183357351 22:37366833-37366855 CTGTGTGAGGGCACGTGGAAGGG + Intergenic
1185097220 22:48817141-48817163 CTGTATCGGCGCACGTACAAAGG - Intronic
1203228569 22_KI270731v1_random:91868-91890 GTGTGTGTGTGCACGTGCACTGG + Intergenic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
954138260 3:48592235-48592257 CTGTGTGGGCCCACCTGCATGGG + Exonic
959453989 3:106536288-106536310 CTGTGTCTTCGCACGTGAAATGG - Intergenic
963837631 3:150073112-150073134 CTGTGTGGTCACACGTGCAGTGG - Intergenic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966886046 3:184378722-184378744 GTATGTGCGCACACGTGCACTGG + Intronic
968623596 4:1615658-1615680 CTGTGTGCGCCCAGGTGGGATGG - Intergenic
973263668 4:48188894-48188916 GTGTGTGCGCGCATATGCATGGG - Intronic
973287229 4:48432096-48432118 GTGTGTGTGCCCACATGCAAGGG - Intergenic
977681946 4:99806921-99806943 CTGTGTGTGCTCACGAGCAATGG - Intergenic
980340442 4:131538185-131538207 ACGTGTGCATGCACGTGCAATGG + Intergenic
982266456 4:153542538-153542560 CTTTGTGTGCGAAAGTGCAATGG + Intronic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
985985552 5:3513069-3513091 CTGTGTGTGCGCGTGTGGAAGGG + Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
1003094821 6:3133739-3133761 CTGTGTGCTCACACGGGCAGTGG - Intronic
1008709931 6:54212557-54212579 CTGTGTGTGTGCACATGCATGGG + Intronic
1015869703 6:137763632-137763654 CTGTGTGTGCGCAGTTGCCATGG - Intergenic
1017221361 6:151969469-151969491 GTGTGTGTGCACACATGCAAGGG + Intronic
1018046843 6:159972771-159972793 CTGTGTCCGTGCACGTGGAGGGG + Intronic
1019696586 7:2449723-2449745 CTGTGTGTGCACGGGTGCAAGGG + Intergenic
1021044621 7:15907052-15907074 GTGTGTACGCACACGTGCACAGG - Intergenic
1022510239 7:30930662-30930684 GTGTGTGTGTGCACGTGCATAGG + Intergenic
1023032915 7:36106763-36106785 GTGTGTGTGCGCACATGTAAGGG - Intergenic
1024267471 7:47617951-47617973 CTGTGTGAGAGCACGTGAATGGG + Intergenic
1026572017 7:71539489-71539511 GTGTGTGCGTGCACGTGTACAGG + Intronic
1027052099 7:75027051-75027073 CTGTGTGTGCACACGTGTATGGG + Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1033725734 7:144115839-144115861 GTGTGTGCGCGCACACGCATGGG - Intergenic
1037723124 8:21461502-21461524 GTGTGTGCGCACATGTGCATGGG - Intergenic
1039053449 8:33514952-33514974 GTGTGTGCGCGCAGGGGCGAGGG + Intergenic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1046619201 8:116510040-116510062 ATGTGTGCACACACGTGCGAGGG - Intergenic
1048014275 8:130483723-130483745 CTGTGTGCACTCAATTGCAATGG + Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1056705406 9:88948381-88948403 ATGTGTGCACGCATGTGCATGGG + Intergenic
1056782705 9:89563267-89563289 GTGTGCGCGTGCACGTGCATAGG - Intergenic
1061650098 9:132040741-132040763 CGGTGTGTGTGCACGTGCACAGG - Intronic
1061935293 9:133854113-133854135 GTGTGTGTGTGCAGGTGCAAGGG - Intronic
1061935297 9:133854136-133854158 ATGTGTGTGTGCAGGTGCAAGGG - Intronic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188752211 X:33918873-33918895 CTGTGTGTGCTCACTTCCAAAGG - Intergenic
1189309382 X:40009131-40009153 TTGTGTGCGCGGACGTCAAAGGG + Intergenic
1192483913 X:71508756-71508778 GTGTGTGCGCGCATATGCATAGG + Intronic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1195939548 X:110156747-110156769 CTGTGTTCTCACACGTGGAAGGG + Intronic
1197555294 X:127945898-127945920 CTGTGTGTGCTCACTTCCAAAGG - Intergenic
1200067293 X:153509957-153509979 CTGTGTGCACCCACTTGCACTGG + Intergenic