ID: 985895919

View in Genome Browser
Species Human (GRCh38)
Location 5:2750078-2750100
Sequence CCTGTGTGCGCGCACGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985895919_985895924 21 Left 985895919 5:2750078-2750100 CCTTGCACGTGCGCGCACACAGG 0: 1
1: 0
2: 0
3: 15
4: 132
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216
985895919_985895925 28 Left 985895919 5:2750078-2750100 CCTTGCACGTGCGCGCACACAGG 0: 1
1: 0
2: 0
3: 15
4: 132
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985895919 Original CRISPR CCTGTGTGCGCGCACGTGCA AGG (reversed) Intronic