ID: 985895922 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:2750101-2750123 |
| Sequence | GATATCAAAGAGCTACCTGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 139 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 130} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985895922_985895925 | 5 | Left | 985895922 | 5:2750101-2750123 | CCCACAGGTAGCTCTTTGATATC | 0: 1 1: 0 2: 0 3: 8 4: 130 |
||
| Right | 985895925 | 5:2750129-2750151 | TTCTGCAGATGCTTGGAGTGCGG | 0: 1 1: 0 2: 0 3: 26 4: 256 |
||||
| 985895922_985895924 | -2 | Left | 985895922 | 5:2750101-2750123 | CCCACAGGTAGCTCTTTGATATC | 0: 1 1: 0 2: 0 3: 8 4: 130 |
||
| Right | 985895924 | 5:2750122-2750144 | TCTAAATTTCTGCAGATGCTTGG | 0: 1 1: 0 2: 1 3: 20 4: 216 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985895922 | Original CRISPR | GATATCAAAGAGCTACCTGT GGG (reversed) | Intronic | ||