ID: 985895922

View in Genome Browser
Species Human (GRCh38)
Location 5:2750101-2750123
Sequence GATATCAAAGAGCTACCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985895922_985895925 5 Left 985895922 5:2750101-2750123 CCCACAGGTAGCTCTTTGATATC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256
985895922_985895924 -2 Left 985895922 5:2750101-2750123 CCCACAGGTAGCTCTTTGATATC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985895922 Original CRISPR GATATCAAAGAGCTACCTGT GGG (reversed) Intronic