ID: 985895923 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:2750102-2750124 |
| Sequence | AGATATCAAAGAGCTACCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 162 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 148} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985895923_985895925 | 4 | Left | 985895923 | 5:2750102-2750124 | CCACAGGTAGCTCTTTGATATCT | 0: 1 1: 0 2: 0 3: 13 4: 148 |
||
| Right | 985895925 | 5:2750129-2750151 | TTCTGCAGATGCTTGGAGTGCGG | 0: 1 1: 0 2: 0 3: 26 4: 256 |
||||
| 985895923_985895924 | -3 | Left | 985895923 | 5:2750102-2750124 | CCACAGGTAGCTCTTTGATATCT | 0: 1 1: 0 2: 0 3: 13 4: 148 |
||
| Right | 985895924 | 5:2750122-2750144 | TCTAAATTTCTGCAGATGCTTGG | 0: 1 1: 0 2: 1 3: 20 4: 216 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985895923 | Original CRISPR | AGATATCAAAGAGCTACCTG TGG (reversed) | Intronic | ||