ID: 985895923

View in Genome Browser
Species Human (GRCh38)
Location 5:2750102-2750124
Sequence AGATATCAAAGAGCTACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985895923_985895925 4 Left 985895923 5:2750102-2750124 CCACAGGTAGCTCTTTGATATCT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256
985895923_985895924 -3 Left 985895923 5:2750102-2750124 CCACAGGTAGCTCTTTGATATCT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985895923 Original CRISPR AGATATCAAAGAGCTACCTG TGG (reversed) Intronic