ID: 985895924

View in Genome Browser
Species Human (GRCh38)
Location 5:2750122-2750144
Sequence TCTAAATTTCTGCAGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985895922_985895924 -2 Left 985895922 5:2750101-2750123 CCCACAGGTAGCTCTTTGATATC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216
985895918_985895924 22 Left 985895918 5:2750077-2750099 CCCTTGCACGTGCGCGCACACAG 0: 1
1: 0
2: 1
3: 11
4: 91
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216
985895923_985895924 -3 Left 985895923 5:2750102-2750124 CCACAGGTAGCTCTTTGATATCT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216
985895919_985895924 21 Left 985895919 5:2750078-2750100 CCTTGCACGTGCGCGCACACAGG 0: 1
1: 0
2: 0
3: 15
4: 132
Right 985895924 5:2750122-2750144 TCTAAATTTCTGCAGATGCTTGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985895924 Original CRISPR TCTAAATTTCTGCAGATGCT TGG Intronic