ID: 985895925

View in Genome Browser
Species Human (GRCh38)
Location 5:2750129-2750151
Sequence TTCTGCAGATGCTTGGAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985895919_985895925 28 Left 985895919 5:2750078-2750100 CCTTGCACGTGCGCGCACACAGG 0: 1
1: 0
2: 0
3: 15
4: 132
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256
985895918_985895925 29 Left 985895918 5:2750077-2750099 CCCTTGCACGTGCGCGCACACAG 0: 1
1: 0
2: 1
3: 11
4: 91
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256
985895922_985895925 5 Left 985895922 5:2750101-2750123 CCCACAGGTAGCTCTTTGATATC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256
985895923_985895925 4 Left 985895923 5:2750102-2750124 CCACAGGTAGCTCTTTGATATCT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 985895925 5:2750129-2750151 TTCTGCAGATGCTTGGAGTGCGG 0: 1
1: 0
2: 0
3: 26
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985895925 Original CRISPR TTCTGCAGATGCTTGGAGTG CGG Intronic