ID: 985896526

View in Genome Browser
Species Human (GRCh38)
Location 5:2752327-2752349
Sequence CCCGGACCTGCTCTGCCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 465}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985896515_985896526 30 Left 985896515 5:2752274-2752296 CCCGCGGCTCGGGTCTTCCTCCG 0: 1
1: 0
2: 1
3: 8
4: 95
Right 985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG 0: 1
1: 0
2: 2
3: 57
4: 465
985896521_985896526 10 Left 985896521 5:2752294-2752316 CCGGGCAGTGCGCGCGGCTCTCA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG 0: 1
1: 0
2: 2
3: 57
4: 465
985896520_985896526 13 Left 985896520 5:2752291-2752313 CCTCCGGGCAGTGCGCGCGGCTC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG 0: 1
1: 0
2: 2
3: 57
4: 465
985896516_985896526 29 Left 985896516 5:2752275-2752297 CCGCGGCTCGGGTCTTCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG 0: 1
1: 0
2: 2
3: 57
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985896526 Original CRISPR CCCGGACCTGCTCTGCCTCC TGG Exonic
900013764 1:135802-135824 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
900043834 1:491785-491807 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
900065271 1:726788-726810 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
900161844 1:1227619-1227641 CCTGACCCTGCTCTGCCTCCAGG + Intronic
900464768 1:2820396-2820418 CCTTGACCTGCACTGGCTCCAGG + Intergenic
900787669 1:4658863-4658885 GCCGGCGCTGCTCTGCCTCCAGG - Intronic
901033695 1:6323415-6323437 CCCTGACCAGGTCTGCCTTCTGG + Intronic
901404618 1:9038049-9038071 CTCGGGCCCGCTCTGCCTTCAGG - Intronic
901462388 1:9399516-9399538 CCCTGCCCTGCTCTGCCCCAGGG + Intergenic
901701439 1:11046770-11046792 CCCAGGCCTGATCTCCCTCCTGG + Intronic
902466105 1:16619767-16619789 CCGGGCCCTGCTCTGCCACTTGG - Intergenic
902508586 1:16953537-16953559 CCGGGCCCTGCTCTGCCACTTGG + Intronic
902509920 1:16960967-16960989 CGCGGGCCAGCTCGGCCTCCAGG - Exonic
902554193 1:17237353-17237375 CCTGCACCTGCTGTGCCTTCAGG - Exonic
902799768 1:18821892-18821914 CCCAGGTCTCCTCTGCCTCCAGG - Intergenic
903263622 1:22143670-22143692 CCCGGCCCCTCCCTGCCTCCTGG + Intronic
903754359 1:25650531-25650553 CCTGGACCTGCTCTCTCTGCGGG - Intronic
903807574 1:26016458-26016480 CCAGGAACTGCTCTGCATCCTGG + Intergenic
904274218 1:29369730-29369752 CCTGGGCTTGCTCTGCTTCCAGG + Intergenic
904277227 1:29392449-29392471 CCTGGATCTCCTCTGCATCCTGG - Intergenic
904423746 1:30410359-30410381 CCTGGGCTTGCTCTGCTTCCAGG - Intergenic
905670658 1:39788452-39788474 CCCCGGCCCGCTCTGGCTCCTGG - Exonic
905884283 1:41483451-41483473 CCTGCACCCGCACTGCCTCCAGG - Intronic
906157543 1:43622568-43622590 GCCGGATCAGCACTGCCTCCCGG - Exonic
906204370 1:43979293-43979315 CCCGGCCCCGCCCTGCCCCCCGG + Intronic
908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG + Exonic
910243092 1:85109578-85109600 CCTGGGCCTGCACTGCATCCTGG - Intronic
910441957 1:87262205-87262227 CTCAGACCTTCTCTCCCTCCTGG - Intergenic
910459032 1:87428378-87428400 CCCGGACCTTCTGGGACTCCTGG - Intergenic
912048134 1:105486600-105486622 CCTGGTCCAGCTCTGCCTCCTGG + Intergenic
913186436 1:116373792-116373814 CCCCGGCCCGCTCGGCCTCCGGG - Intronic
913580803 1:120224925-120224947 CCCTGACCTCTTGTGCCTCCCGG + Intergenic
913627375 1:120673474-120673496 CCCTGACCTCTTGTGCCTCCCGG - Intergenic
913662465 1:121016447-121016469 CCCGCAGCTTCTCTCCCTCCGGG + Intergenic
914243990 1:145872527-145872549 CCAGCACCTGCTGGGCCTCCCGG + Exonic
914391935 1:147231859-147231881 CCCTGACCTCCTGTGCTTCCCGG + Intronic
915441957 1:155950993-155951015 CCCGGGCCTGCTCACTCTCCCGG + Exonic
915937516 1:160098148-160098170 CCAGGCACTGCTCGGCCTCCCGG - Intronic
918357255 1:183716870-183716892 CCAGGACCTTCACTGCATCCAGG - Intronic
920274288 1:204792552-204792574 ACCGGCCCTGCTCTGAATCCTGG - Intergenic
920684154 1:208096321-208096343 CCCAGACTTCCTCTGCCTGCAGG + Intronic
921287813 1:213624682-213624704 CTCAGACCTGCTCAGCCTCCTGG - Intergenic
922734575 1:227972320-227972342 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
922734860 1:227973462-227973484 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
922787587 1:228290633-228290655 CCCGGACATGCCCTGCATGCAGG - Intronic
922847702 1:228702423-228702445 CCTGGCCCAGCTTTGCCTCCTGG - Intergenic
924343359 1:243054398-243054420 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
924384201 1:243487562-243487584 CCAGGCCCTGCCCTGCCTCCAGG - Intronic
924775455 1:247112293-247112315 CCCGGCCATGCTCGGGCTCCAGG + Exonic
1062834565 10:627214-627236 CCCGAAGCTGCTTTCCCTCCAGG + Intronic
1062967230 10:1617034-1617056 CCCTGCTGTGCTCTGCCTCCTGG + Intronic
1062967301 10:1617503-1617525 CCCTGCTGTGCTCTGCCTCCTGG + Intronic
1063566235 10:7174094-7174116 CCCGGAGCAGGTGTGCCTCCTGG - Intronic
1063995080 10:11611495-11611517 GCCGGATCTGCTCGGCCGCCCGG - Intronic
1065976411 10:30846523-30846545 CCTGGCCCAGCTCTGCCTCAGGG - Intronic
1066733121 10:38451141-38451163 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1067688731 10:48486413-48486435 CCGCAACCTCCTCTGCCTCCTGG + Intronic
1069359663 10:67627185-67627207 CCTGGTCCAGCTCTGCCTCCTGG + Intronic
1069817133 10:71204827-71204849 CGGGGACCTCCTCTTCCTCCTGG + Intergenic
1069817916 10:71210273-71210295 CCGGGCCCTGCTCTCCCTCCAGG - Intergenic
1069828471 10:71268539-71268561 CCAGGATCTGAGCTGCCTCCTGG + Intronic
1070768524 10:79069610-79069632 CCCGGTCCTGCCCGGCCCCCGGG - Intronic
1073101007 10:101006709-101006731 CCCGCAGCTGCTCAGCTTCCTGG - Exonic
1074079144 10:110153594-110153616 CCCTGGCCTTATCTGCCTCCTGG + Intergenic
1075090101 10:119439365-119439387 CCAGGCCCTGTTCTGCCTTCAGG + Intronic
1075731089 10:124637272-124637294 CCTGGACCTGCGCTGCCTCATGG - Intronic
1076779194 10:132714600-132714622 CTGGGACCTGCCCTCCCTCCTGG - Intronic
1076970108 11:128016-128038 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1079032975 11:16999328-16999350 CCAGGCCCTCCTCTGCCTGCAGG + Intronic
1079274046 11:19017038-19017060 CCTGGACATGCCCTGCCTCAAGG - Intergenic
1080614752 11:33936099-33936121 CCTGCAGCAGCTCTGCCTCCTGG + Intergenic
1080746917 11:35116453-35116475 CCCAGCCCTGCTCTGACTCATGG + Intergenic
1081739060 11:45425453-45425475 CCAAGACCTGGTCTGGCTCCTGG - Intergenic
1081804200 11:45881405-45881427 CTCCGGCCTGCTCAGCCTCCAGG - Exonic
1081871949 11:46387023-46387045 CCAGGCCTTGCGCTGCCTCCAGG - Intergenic
1082260268 11:50072668-50072690 CCAGGCCCAGCTCTTCCTCCTGG - Intergenic
1082260980 11:50076190-50076212 CCAGGCCCAGCTCTTCCTCCTGG - Intergenic
1082261181 11:50077190-50077212 CCAGGCCCAGCTCTTCCTCCTGG - Intergenic
1083302218 11:61745211-61745233 CCCAGGCCTGCCCTGCCTGCTGG + Exonic
1083419904 11:62546779-62546801 CTCGGAGCTGCTCTGCCGCGGGG - Exonic
1083506238 11:63160247-63160269 CCTGGACCTCCTAGGCCTCCAGG - Intronic
1083664795 11:64268570-64268592 TCCAGGCCTGCCCTGCCTCCAGG - Exonic
1083777928 11:64903241-64903263 CCTGCACCTGCTGTGGCTCCAGG + Intronic
1083899629 11:65637280-65637302 CCTGGGCCTGCACTGCCTGCAGG + Exonic
1084066523 11:66707536-66707558 CCAGGACCTGCTCTACCTCATGG - Exonic
1084114097 11:67031798-67031820 CCTGAACCTGCTTTGCCACCTGG + Intronic
1084273998 11:68042719-68042741 CCGGGACCTGCTGCGCATCCAGG + Exonic
1084519969 11:69657112-69657134 CCCCTACCTGCCCTGCCTCCTGG + Intronic
1085353458 11:75815459-75815481 CCGGCCGCTGCTCTGCCTCCCGG + Exonic
1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG + Intronic
1085522489 11:77146636-77146658 CCCCCACCTGCTCCTCCTCCAGG - Intronic
1085689557 11:78654185-78654207 CCCGGGCCAGGTCTGGCTCCTGG + Exonic
1086424714 11:86672180-86672202 CCCGCACCGGATCTGCTTCCAGG - Intronic
1089500442 11:118928813-118928835 CCCGGATCGGCTCTTCCTCCAGG - Intronic
1089579101 11:119470421-119470443 CCCAGGCCAGCCCTGCCTCCTGG - Intergenic
1089591631 11:119545942-119545964 CCCAGCCCAGCTCTGCCTCAGGG - Intergenic
1089760277 11:120717865-120717887 CCCCCAGCTGCTCAGCCTCCAGG - Intronic
1089940808 11:122414846-122414868 CCAGGTCCAGCTATGCCTCCTGG - Intergenic
1090056829 11:123430957-123430979 CCCGGGCCAGCCCGGCCTCCAGG - Exonic
1090820165 11:130334976-130334998 CCTGGCCCAGCTGTGCCTCCTGG - Intergenic
1091297674 11:134485455-134485477 CCCAGGCCTGCTCTGCTTCCCGG - Intergenic
1091466852 12:692254-692276 CCTGGCCCAGCTGTGCCTCCTGG - Intergenic
1091581993 12:1795895-1795917 CCCCGACCCGCCCTGCCTCATGG - Intronic
1091635116 12:2191051-2191073 ACCACACCTGCTCTTCCTCCTGG - Intronic
1092767250 12:11863722-11863744 TCCGGAGCTTCTCTGCCTGCCGG + Intronic
1093418039 12:18943155-18943177 CCCAGAGCTGCCCTTCCTCCTGG - Intergenic
1093746006 12:22741803-22741825 CCTGGAGCTGCTGTGCCTCAGGG + Intergenic
1093990745 12:25587359-25587381 CCAGTATCTGCTCTGCTTCCAGG + Intronic
1094048699 12:26195803-26195825 CCCGGACCTGCTGCGGCTGCCGG + Exonic
1096072433 12:48782759-48782781 CCCCGACCTGCACTGCCGCCAGG + Exonic
1096770193 12:53930729-53930751 ACTGGACCTGCTCTGGCGCCAGG + Intergenic
1096804645 12:54133136-54133158 CACAGACCTGCTCTGCAACCTGG - Intergenic
1097166483 12:57089009-57089031 CCCGGAGCTGCGCTGGCTGCCGG - Exonic
1097896756 12:64832154-64832176 CCCTGTCCTGCTCAGCCTCCTGG - Exonic
1098105998 12:67069400-67069422 CCCGGCCCGGCCCGGCCTCCCGG - Intergenic
1101881405 12:108628591-108628613 CCCCCACCTTCTCTGCTTCCAGG - Intronic
1102031756 12:109743831-109743853 CCCGGCCCTGCTCGGCATCTGGG - Intronic
1102146004 12:110655560-110655582 TCCTGGCCTGCTCTGCCTCTAGG + Intronic
1102458544 12:113086337-113086359 CCCAGACCCACTCTGCCTCAGGG - Intronic
1102477879 12:113200585-113200607 TCAGCGCCTGCTCTGCCTCCCGG + Intronic
1102570162 12:113822646-113822668 CCTGTTCCTGCTCTCCCTCCAGG - Intronic
1104140534 12:125983149-125983171 CACAGACCTGCTCTGTCCCCTGG - Intergenic
1104636778 12:130442505-130442527 CCAGGATGTGCTCTCCCTCCAGG + Exonic
1106516092 13:30455292-30455314 CCAGGCCTTGCTCTGCCACCTGG - Intergenic
1106754994 13:32813709-32813731 CCCAGACTTGTTCTGCCTCTGGG + Intergenic
1107820485 13:44281334-44281356 CCAGGACCAGCTCTGCATGCAGG - Intergenic
1108506971 13:51121044-51121066 CCCTGACCTCTTCTGCCCCCTGG + Intergenic
1111437032 13:88224551-88224573 CCCAGACAAGCTCCGCCTCCCGG + Intergenic
1113657749 13:112079406-112079428 GTCCCACCTGCTCTGCCTCCGGG + Intergenic
1114493529 14:23117864-23117886 CCCGCCTCCGCTCTGCCTCCTGG - Intronic
1116849408 14:49893299-49893321 CCCGGAGCCGCGCTGCCTCTCGG + Exonic
1118776874 14:68978881-68978903 CCCCGACCCGCTCTGCCTGCCGG - Intronic
1119124770 14:72115532-72115554 CCCTCACCTCCTCTGACTCCTGG - Intronic
1121438535 14:93934399-93934421 CCCAGACCTTCTCTACCTTCAGG - Exonic
1121600517 14:95199824-95199846 CCAGGCTCTCCTCTGCCTCCAGG - Intronic
1121717044 14:96083848-96083870 CCCCTCCCTTCTCTGCCTCCCGG - Intronic
1122079147 14:99254716-99254738 CCCGGGCCGGCTGTCCCTCCAGG - Intronic
1122313055 14:100809432-100809454 CCCTGACCTGCTAGGCTTCCTGG + Intergenic
1122379372 14:101290733-101290755 CCCGGAGCTGCTCTCTCTCCAGG + Intergenic
1122787794 14:104171920-104171942 CCCGTACCTGCTCGGAGTCCTGG - Exonic
1122811034 14:104288033-104288055 CCGAGACCAGCTGTGCCTCCGGG + Intergenic
1122929679 14:104927547-104927569 CCCGGACCTGGGCTGCCACTGGG - Intronic
1122959195 14:105086916-105086938 CCCGGAGCTGCCCTGCCGCCTGG + Intergenic
1123016181 14:105376803-105376825 CCAGGTCCTCCTCTGCCTCGGGG - Exonic
1123539178 15:21270657-21270679 CCAGGACCTGCTCTGCCTGTGGG + Intergenic
1124401191 15:29349021-29349043 CCAGGCCCTGCTCTGCCAACTGG - Intronic
1126697762 15:51340705-51340727 CCAATACCTGCTCTGCCTCGAGG - Intergenic
1126897228 15:53272102-53272124 CCCTTTCCTGCTCTTCCTCCTGG + Intergenic
1128108028 15:65058642-65058664 CCCCAACCTCCTCTGCCCCCCGG - Intronic
1128155036 15:65386588-65386610 CCTGGGCCTCCTCTGCCTCCTGG - Exonic
1128240884 15:66100252-66100274 CCAGGCCTTGCCCTGCCTCCTGG + Intronic
1128986897 15:72228862-72228884 CCTTGACTTGCTCTGCCTGCTGG - Intronic
1129192241 15:73944321-73944343 CCCGGACCTGCGCTCCCAGCTGG + Intronic
1129457381 15:75683098-75683120 CCCGGCCCTGGGCTGCCACCAGG + Intronic
1130274445 15:82469195-82469217 CCCGGCCCTGGGCTGCCACCAGG - Intergenic
1130381404 15:83375335-83375357 CCTGGACCTCCTGTACCTCCTGG - Intergenic
1130466792 15:84196569-84196591 CCCGGCCCTGGGCTGCCACCAGG - Intergenic
1130497472 15:84476967-84476989 CCCGGCCCTGGGCTGCCACCAGG + Intergenic
1130589087 15:85201162-85201184 CCCGGCCCTGGGCTGCCACCAGG - Intergenic
1131469628 15:92684811-92684833 CCCTGGCCTGCCCTTCCTCCAGG + Intronic
1131612935 15:93984021-93984043 CCCGTCTCTGCTCTGCCCCCAGG + Intergenic
1132590558 16:724574-724596 CCCGGCACTGCTCAGCCTGCTGG - Intronic
1132932212 16:2464500-2464522 CCCTGCCCTGCCCTGCCCCCAGG + Exonic
1132959595 16:2614445-2614467 CCCTGGCCTGCTCTCCCTCAAGG + Intergenic
1132972656 16:2696420-2696442 CCCTGGCCTGCTCTCCCTCAAGG + Intronic
1133056870 16:3149781-3149803 CCGGCGCCGGCTCTGCCTCCAGG + Exonic
1133305674 16:4806879-4806901 GCCAGCTCTGCTCTGCCTCCCGG + Intronic
1136227713 16:28870201-28870223 CCTGGCCCTGCTCTGTGTCCCGG + Intronic
1136395833 16:29991943-29991965 CCCAGACCTGCTCTGCCCTGTGG - Intronic
1136591313 16:31219375-31219397 CCCGTACACGCTCTGCCTCGCGG - Exonic
1137967700 16:52953054-52953076 TCCGTATCTGCTTTGCCTCCAGG + Intergenic
1138817561 16:60220600-60220622 CCTGGCCCAGCTCTACCTCCTGG - Intergenic
1139923412 16:70473214-70473236 CCGGGACCTGTTCTTCCGCCAGG + Exonic
1141481712 16:84310981-84311003 CCCTGGCTTGCGCTGCCTCCTGG - Intronic
1141959089 16:87392564-87392586 ACCGGCCCCGCTCGGCCTCCCGG - Intronic
1142175513 16:88643324-88643346 CCCGGACCTGCCCTCCCGCCAGG - Exonic
1142203274 16:88771104-88771126 GCCTGCCCTGCTCTGCCTCACGG - Intronic
1142450569 16:90171116-90171138 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1142456992 17:62575-62597 CCGGGCCCAGCTCTTCCTCCTGG - Intergenic
1142499497 17:324277-324299 CCTCCACCTGCTCCGCCTCCGGG + Intronic
1142974789 17:3636872-3636894 CGCTGACCTGCTGTGCCTCAAGG - Intronic
1143234910 17:5391203-5391225 CACGTACCCGCACTGCCTCCTGG - Intronic
1143502568 17:7347777-7347799 GCCGCAGCTGCCCTGCCTCCTGG + Intronic
1143563369 17:7708006-7708028 GCTAGACCTGCTCTGCCCCCGGG + Exonic
1146208297 17:30922740-30922762 CCGGGCCCTGAACTGCCTCCAGG + Intronic
1147490670 17:40863238-40863260 CCTGGAGCAGCTGTGCCTCCAGG + Exonic
1147649581 17:42054266-42054288 GCTGGTCCTGCTCTGCCTGCTGG + Intronic
1147998825 17:44375892-44375914 CTCCGACCTGCTCTACATCCTGG - Exonic
1148052915 17:44777930-44777952 CCTGGCCCTGCCCTGCCTCTAGG + Exonic
1148148132 17:45378938-45378960 CCCGGCCCTGCCCTGCCTGCTGG + Intergenic
1148174193 17:45549954-45549976 CCAAGAACTGCTCTGGCTCCAGG + Intergenic
1148275069 17:46295493-46295515 CCAAGAACTGCTCTGGCTCCAGG - Exonic
1148297176 17:46513072-46513094 CCAAGAACTGCTCTGGCTCCAGG - Exonic
1148334254 17:46831329-46831351 CCAGCATCTGCTCTGCCTCAAGG + Intronic
1148361732 17:47017552-47017574 CCAAGAACTGCTCTGGCTCCAGG - Intronic
1148861704 17:50607952-50607974 GCCGGGCCTCCTCTTCCTCCTGG - Exonic
1150405411 17:64896876-64896898 CCAAGAACTGCTCTGGCTCCAGG + Exonic
1151353412 17:73544833-73544855 CCAGGACCTGCTGTTCATCCAGG + Intronic
1151732495 17:75919756-75919778 CACGGGCCTGTTCGGCCTCCTGG + Exonic
1151744719 17:76005730-76005752 CCCTCACCTGCCCTGCCTGCAGG + Exonic
1151975296 17:77480845-77480867 CCAGGCCCTGCTCTGCCTGCGGG - Intronic
1151975438 17:77481422-77481444 CCAGGAACAGCTCTGCATCCAGG + Intronic
1152240674 17:79159286-79159308 CCCGGGCCAGCTCTACCCCCAGG - Intronic
1152379563 17:79935308-79935330 TCCGGAGCTGCTCTTCCTCCTGG + Exonic
1152706526 17:81846393-81846415 CCCGGGCCAGGGCTGCCTCCCGG - Intronic
1152732074 17:81977433-81977455 CGCGGTCGTCCTCTGCCTCCGGG - Intronic
1152800231 17:82327402-82327424 CCCCGACCTGCTCTGGATGCTGG + Intronic
1153201765 18:2655186-2655208 CACGGACCCGCTTTGCCTCGGGG + Intergenic
1154005261 18:10521954-10521976 CCCATACCTGCTCTCCCTTCAGG - Intergenic
1156337063 18:36181662-36181684 CTGGGACCTACTCTGCCTCTAGG - Intergenic
1156489080 18:37485751-37485773 CTCGGAGCTTCTCTGCCTCTCGG + Intronic
1156894452 18:42229539-42229561 CCTGGAACTTCTCAGCCTCCAGG - Intergenic
1157326500 18:46672737-46672759 CCTGGCCTTGCTCTGCCACCTGG - Intronic
1157859142 18:51125240-51125262 CCCTTACATCCTCTGCCTCCTGG - Intergenic
1158541698 18:58362144-58362166 CCCTTGCCTGCTCTGTCTCCTGG - Intronic
1158893729 18:61894743-61894765 CCCGGCCCTGCCCCTCCTCCCGG - Intergenic
1159969550 18:74632507-74632529 CCTGGCCCTGCTCTGCCTCCTGG - Exonic
1160646906 19:197934-197956 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1160658997 19:289732-289754 CGCCGTCCTGCCCTGCCTCCAGG - Intronic
1161326806 19:3668038-3668060 CCCAGCCCTGCCCTGGCTCCTGG + Intronic
1161487117 19:4542556-4542578 TCTGGCTCTGCTCTGCCTCCTGG - Intergenic
1161517074 19:4702552-4702574 CCCGGGCGTGCTTTTCCTCCTGG - Intronic
1161572893 19:5040075-5040097 ACCGCACCTTCTCTGCCCCCAGG - Intronic
1162301426 19:9847293-9847315 CCCTGGCCTCCTCCGCCTCCTGG + Intronic
1162706084 19:12555703-12555725 CCCGGATCTGCGCGGCTTCCTGG - Intronic
1162746988 19:12804306-12804328 CCCGGCCCTGCTCTCTCACCCGG - Intronic
1162833070 19:13298953-13298975 CCCGGCTCAGCTCGGCCTCCTGG + Exonic
1163121569 19:15221487-15221509 CACGGTCTTGCTCTGTCTCCAGG + Intergenic
1163725625 19:18921675-18921697 CCCGGAACTGCTCTGCGATCTGG - Exonic
1163773438 19:19204384-19204406 CCCCGAACTTCACTGCCTCCCGG + Intergenic
1164983294 19:32630247-32630269 CCAGGACCCACTCTGGCTCCAGG + Intronic
1165763576 19:38336505-38336527 CCCGCCCCTGCTCTTGCTCCCGG - Intronic
1165763585 19:38336529-38336551 CCCGCCCCTGCTCTTGCTCCCGG - Intronic
1165763686 19:38336951-38336973 CCCGCCCCTGCTCTTGCTCCTGG - Intronic
1165763710 19:38337047-38337069 CCCGCCCCTGCTCTTGCTCCTGG - Intronic
1166198611 19:41221974-41221996 CGTGGACCTACTCTGGCTCCAGG + Exonic
1166311941 19:41967763-41967785 CCCTGCCCTTCTGTGCCTCCAGG - Exonic
1166524337 19:43501790-43501812 CCCGCAGCTGCTCCTCCTCCCGG + Exonic
1167648995 19:50719515-50719537 CCCGGGCCCGCTCGCCCTCCGGG - Intergenic
1167674324 19:50875016-50875038 CCAGCCCCAGCTCTGCCTCCGGG - Intronic
1167721969 19:51185500-51185522 ACCTGACCTGCTCTGTGTCCTGG + Intergenic
1167727443 19:51225863-51225885 ACCTGACCTGCTCTGTGTCCTGG + Exonic
1168410247 19:56135424-56135446 GCTGGACCTGCCCTACCTCCAGG - Intronic
925838959 2:7972868-7972890 CCCGCACCTGCCCTGCCTGGGGG + Intergenic
926310016 2:11668602-11668624 CCAGGCCCTGCTGGGCCTCCAGG - Intronic
926394493 2:12427268-12427290 CCAGGACAGGCACTGCCTCCTGG + Intergenic
927464610 2:23327782-23327804 CCCTGGCTTGCTCTGCTTCCTGG - Intergenic
927843915 2:26461678-26461700 CCCTGCCCTGCTCTGCACCCAGG + Exonic
928298005 2:30102144-30102166 CCCAAACCTGCTTTTCCTCCTGG - Intergenic
929080173 2:38114563-38114585 TACTGACATGCTCTGCCTCCTGG + Intergenic
929403488 2:41612729-41612751 CAGGGAACTGCTCTGCCTGCAGG - Intergenic
929790911 2:45022220-45022242 CCCAGACCTGTTCAGCCTCAGGG - Intergenic
932589894 2:73059027-73059049 CAAGGTCCAGCTCTGCCTCCAGG + Intronic
933747919 2:85584399-85584421 CCCGCCCCTGCTCTTCCTCCGGG + Exonic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935593522 2:104862540-104862562 CCCAGCCCTGCCCTCCCTCCCGG - Intergenic
935901621 2:107799103-107799125 ACCTGACCTGCTCAGCCTGCAGG + Intergenic
936032703 2:109085113-109085135 CCCGGTCCTCCTCGGCTTCCTGG - Intergenic
937886016 2:126900455-126900477 CCCAAACCTGTTCTTCCTCCAGG + Intronic
938091587 2:128438106-128438128 CCTGGACTGGCACTGCCTCCTGG + Intergenic
938161459 2:128988146-128988168 CCCGCACCTCCTCAGCCTCCTGG - Intergenic
938714737 2:134009051-134009073 CCTGGAGCTCTTCTGCCTCCAGG - Intergenic
941396407 2:164979261-164979283 CCAGGACCTGCTCTGCCTGTGGG + Intergenic
942122481 2:172792136-172792158 CCAGCACCAGCTCTGCCTCCCGG + Intronic
943364887 2:186959275-186959297 CCAAGACCTGCTCTGTCTCCCGG - Intergenic
944766808 2:202872075-202872097 CCCGGACCTGCCGGGCCTTCTGG + Intergenic
947583543 2:231336980-231337002 CCCGGTCCTGCTGTGCCTAGAGG + Intronic
948212748 2:236207157-236207179 CTGGGTCCTGCTCTGCATCCTGG - Intronic
948292037 2:236832664-236832686 CCTGCACCTGCTCTGCCTGATGG + Intergenic
948600515 2:239105343-239105365 CCAGGAGCTGTTCTGGCTCCCGG + Intronic
948701684 2:239764610-239764632 GCAGGGCCTGCTCTGCCCCCAGG - Intronic
1169382508 20:5120165-5120187 CCCGGACTTGTTCTGCGGCCGGG - Intronic
1172248994 20:33465766-33465788 TGCCCACCTGCTCTGCCTCCTGG + Intergenic
1172447461 20:35000705-35000727 CCTGCACCTGCTCTGTCCCCAGG - Intronic
1173647851 20:44644672-44644694 CCCAGGGCTGCTCTGTCTCCTGG - Intronic
1175215283 20:57389294-57389316 CCCGGGGCTGCCCTGCCGCCTGG + Intergenic
1175439523 20:58981146-58981168 CGCGGCCCTGCCCTTCCTCCAGG + Intergenic
1175966527 20:62662676-62662698 CCCAGACCTGCCCAGGCTCCGGG - Intronic
1175972743 20:62695105-62695127 CCTGCACCTGCTCTGCGTCCTGG + Intergenic
1176102701 20:63371808-63371830 CCTGGAGCTGCTCTGTCTCCAGG + Intronic
1176383560 21:6125972-6125994 CACGGAGCTGCTCTGTCTCCAGG + Intergenic
1176423556 21:6534014-6534036 CCCTGCCCTGCCCTGCCTCCAGG - Intergenic
1179249151 21:39658267-39658289 TTGGCACCTGCTCTGCCTCCTGG + Intronic
1179699050 21:43142330-43142352 CCCTGCCCTGCCCTGCCTCCAGG - Intergenic
1179739910 21:43412266-43412288 CACGGAGCTGCTCTGTCTCCAGG - Intergenic
1180080833 21:45486921-45486943 CCCGGACCTGCTGGACCACCAGG + Exonic
1180089600 21:45527249-45527271 CCAGGGCCTGCCCCGCCTCCAGG - Intronic
1180149032 21:45938338-45938360 CCAGGAGCTGCTCTCCCTCCTGG + Intronic
1180155811 21:45977055-45977077 CCCTGCCCTCCCCTGCCTCCCGG + Intergenic
1180731461 22:17985464-17985486 GCAGGACCTGCTCATCCTCCCGG - Intronic
1180915075 22:19480093-19480115 CCCGGCCCTCCCCTGCCTCCCGG - Intronic
1181439895 22:22930345-22930367 CCCAGGCCTGGGCTGCCTCCAGG + Intergenic
1181464328 22:23102606-23102628 CCCACACCTGCTCTGCCTGCAGG + Intronic
1181516495 22:23416685-23416707 GCAGGACCTGCTCATCCTCCTGG - Intergenic
1182293318 22:29298735-29298757 CCAGGACCTCCTGGGCCTCCTGG - Exonic
1182835147 22:33335708-33335730 CCCGAACCTGTCCTGCCTCAGGG + Intronic
1183040501 22:35174270-35174292 CCATGACCTGCCCTGCTTCCTGG - Intergenic
1183688714 22:39376277-39376299 CTGGGACCCGCTCTGCCTCTGGG + Intronic
1183933641 22:41249700-41249722 CCCGGGCCTGCTGTTCCTTCCGG + Intronic
1184362105 22:44024722-44024744 CCCGCGCCTGCTCTGCCTGCCGG + Intronic
1184381356 22:44146867-44146889 TCTGAACATGCTCTGCCTCCAGG + Intronic
1184409329 22:44317550-44317572 CCCAAACCTGCTGTGCCGCCAGG + Intergenic
1185178880 22:49347979-49348001 CCAGGGCCTTCTCTGCATCCTGG + Intergenic
1185335203 22:50268183-50268205 CCTGGACCTTCTCTGTCCCCTGG + Intronic
949663061 3:6303955-6303977 CCCTGAACTGCCCTGCCCCCCGG + Intergenic
949895959 3:8767845-8767867 GCCCGACCTGCTGTGCCGCCTGG - Exonic
950450193 3:13060964-13060986 CCGAGCCCTGCACTGCCTCCAGG + Intronic
950682431 3:14594351-14594373 CCCGAGTCTGCTCTTCCTCCTGG - Intergenic
950921019 3:16694975-16694997 CCTGGCCCAGCTATGCCTCCTGG + Intergenic
952737545 3:36705373-36705395 GGCGGAGCTGCTCTCCCTCCTGG - Intergenic
952744540 3:36764552-36764574 CCCGGCCCCGCCCGGCCTCCAGG - Intergenic
953191854 3:40695139-40695161 CCTGCCCCTGCTCTGCCTCTTGG - Intergenic
953449265 3:42992496-42992518 CCAGGCCTTGCTATGCCTCCAGG - Intronic
953903483 3:46856769-46856791 CCTGGAGCTGCCCTGACTCCTGG + Intergenic
953999763 3:47546806-47546828 CAAGGTCTTGCTCTGCCTCCTGG - Intergenic
954684831 3:52364829-52364851 GCAGGAGCTGATCTGCCTCCGGG + Exonic
954977600 3:54711340-54711362 TCCAGAACTGCTCTGTCTCCGGG - Intronic
956129495 3:66039788-66039810 CGCGGACATGCCCTGCGTCCTGG + Intergenic
956868457 3:73392253-73392275 CCCGGTCTAGCTCTGCCACCTGG - Intronic
961327747 3:126119362-126119384 CCTAGACCTGCTCTTCCTCCAGG + Intronic
961547404 3:127644833-127644855 CCTGCACCTCCTCTGCCTCCTGG - Intronic
961650734 3:128415590-128415612 CCTTGCCCTGCTCTGTCTCCAGG + Intergenic
966210466 3:177448119-177448141 CCCTGACCTGCTCCAGCTCCCGG + Intergenic
966465319 3:180225246-180225268 CCCTGCCCTGCCCTGCCTGCAGG - Intergenic
966812450 3:183859200-183859222 CACGGGCAAGCTCTGCCTCCTGG - Intronic
968359645 3:198138108-198138130 CCCGTGACTGCACTGCCTCCTGG + Intergenic
968370775 3:198221588-198221610 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
968731446 4:2271149-2271171 CCGGGCCCTGTTCTGACTCCAGG - Intronic
968732293 4:2275043-2275065 CCGGGCCCTGTTCTGACTCCAGG - Intronic
968930489 4:3576223-3576245 CCCAGCTCTGCTCTGCCACCAGG - Intergenic
969183065 4:5456608-5456630 CCAGGTCCTGCACTGCCCCCTGG + Intronic
969250901 4:5968129-5968151 CCTGGTCATGCTCTTCCTCCAGG + Intronic
969423388 4:7109905-7109927 CCCAGAGCAGCTCAGCCTCCAGG + Intergenic
969489693 4:7491983-7492005 CCCTGCCCTGCCCAGCCTCCAGG - Intronic
969689873 4:8698535-8698557 CCCTGCCCTCCTCTGCCTCCTGG - Intergenic
969845993 4:9920516-9920538 CCAGGACCTCCTCTACCTCTTGG + Exonic
970616709 4:17774454-17774476 CCCAGCCCTGCCCTGCCTCTGGG - Intronic
973585600 4:52387783-52387805 CCCCAACCATCTCTGCCTCCTGG + Intergenic
973773419 4:54226244-54226266 CCGTGCCCTGCCCTGCCTCCAGG - Intronic
975469323 4:74747220-74747242 CTCTGCCCTGCTCTGTCTCCAGG + Intronic
976362988 4:84202507-84202529 CCCTGACCTGTTGTGCTTCCTGG - Intergenic
977836119 4:101647860-101647882 CTGAGCCCTGCTCTGCCTCCTGG + Intronic
978221216 4:106276818-106276840 CCTGGAACTGCACCGCCTCCTGG - Intronic
979259455 4:118634089-118634111 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
981569333 4:146134823-146134845 CCCAGATCTGCTGTGCATCCTGG + Intergenic
982753786 4:159194338-159194360 CCAGGACCTGATCTGCCTGAAGG - Intronic
984995298 4:185425245-185425267 CCCACACCTGCTCTTCCTCCAGG - Intronic
985530491 5:431130-431152 CCCTGCCCTGCTCTGACACCAGG - Intronic
985794742 5:1953616-1953638 CCCTGACCTGTTGTGCTTCCTGG - Intergenic
985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG + Exonic
986060701 5:4187650-4187672 CCCAGAGCAGCTCAGCCTCCTGG + Intergenic
987901154 5:24013458-24013480 CGCAGACCTGCTCTGCTTCTGGG + Intronic
990996167 5:61734237-61734259 CCCTAACCTGTTTTGCCTCCAGG - Intronic
991494509 5:67214304-67214326 CCAGGACCACCTTTGCCTCCTGG - Intergenic
992038951 5:72809288-72809310 CCCCGACCCGCTGTGCTTCCCGG + Intergenic
992050892 5:72939630-72939652 CACTGCCCAGCTCTGCCTCCCGG - Intergenic
992460326 5:76954033-76954055 CCTGGACATGCTGAGCCTCCAGG + Exonic
992522280 5:77566769-77566791 CACAGACCTGCTATGCCTCAGGG + Intronic
995485783 5:112638711-112638733 GCCTGACCTAGTCTGCCTCCTGG - Intergenic
998430778 5:142068136-142068158 CCCAGACCTGCCCTTCCTGCAGG + Intergenic
998498332 5:142610496-142610518 CCTGGACCTGATCTTCTTCCAGG + Intronic
1001223478 5:169924083-169924105 CCCTGCCCTGCTGTGCCCCCTGG + Intronic
1001600809 5:172926910-172926932 CCAGGATCTGTTCTGCCTCCAGG + Intronic
1001708334 5:173758215-173758237 CCCAGACTTTCTCTGTCTCCTGG - Intergenic
1001969637 5:175944126-175944148 CCTGGAATTTCTCTGCCTCCTGG + Intronic
1002170117 5:177370245-177370267 CCAGGACAGGCTCTGCCTCCAGG - Intronic
1002247797 5:177899627-177899649 CCTGGAATTTCTCTGCCTCCTGG - Intergenic
1002278267 5:178116722-178116744 CCTGGACCTGCGATGCCTCGTGG + Intronic
1002440024 5:179259411-179259433 CCCGGTCCTGCTGTGCGTGCCGG + Intronic
1002575528 5:180171837-180171859 CCAGGACCTGCTCGGCAGCCAGG + Intronic
1002730009 5:181327144-181327166 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1003116519 6:3287135-3287157 CCAGGGGCTGCGCTGCCTCCTGG + Intronic
1003525492 6:6893330-6893352 ACCGGACCAGCTCAGTCTCCAGG - Intergenic
1004180795 6:13378996-13379018 CCTGGAGCTGGTTTGCCTCCTGG - Intronic
1005354649 6:24970485-24970507 CCTGCACCTTCTCTGACTCCAGG + Intronic
1005811452 6:29519306-29519328 CCTGGCCCTAGTCTGCCTCCAGG + Intergenic
1006103760 6:31703375-31703397 CCCGTACCGGCTCCGCCTCCGGG + Exonic
1006296283 6:33171492-33171514 CCTGGTCCTGCTGGGCCTCCAGG - Exonic
1006565908 6:34956961-34956983 CCCTGGCCTCCTCTGCCACCTGG + Intronic
1007417158 6:41698410-41698432 CCCGGACACCCTCTGGCTCCTGG - Intronic
1007727063 6:43922957-43922979 CCCGGACATCCTCTGCTTCCTGG - Intergenic
1008381616 6:50844118-50844140 CCAGAACCTGCTCTGCCGGCCGG - Exonic
1010211214 6:73363874-73363896 CCCTGACTGGCTCTGGCTCCAGG - Exonic
1014254634 6:119148519-119148541 CCCGCCCCTGCTCTGCCTGCAGG + Intronic
1019388870 7:774183-774205 CCCGTACCTGCTCTGCCGACAGG - Exonic
1019701526 7:2476798-2476820 CCTGGCCCGGCTCTTCCTCCGGG + Intronic
1019894169 7:3970869-3970891 GGGGGACCTGCTCTGCTTCCAGG - Intronic
1020112038 7:5452639-5452661 CCCAGGCCTGGTCAGCCTCCAGG + Intronic
1021493893 7:21251051-21251073 CCCACCCCTGCCCTGCCTCCCGG + Intergenic
1021891804 7:25193826-25193848 CCCTGACCCCTTCTGCCTCCAGG + Intergenic
1022044092 7:26609676-26609698 CCGGATCCTGCTGTGCCTCCAGG - Intergenic
1023400744 7:39792020-39792042 CCAGGCCCAGCTCTTCCTCCCGG + Intergenic
1023400899 7:39792617-39792639 CCAGGCCCAGCTCTTCCTCCCGG + Intergenic
1023401182 7:39793713-39793735 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1023817426 7:43961610-43961632 CCTGGACCTGCTCTTCCAGCTGG - Intergenic
1023902173 7:44490349-44490371 CCCCGGCCTGCCCTGACTCCTGG - Intronic
1024074209 7:45810535-45810557 CCAGGCCCAGCTCTTCCTCCCGG + Intergenic
1024074353 7:45811086-45811108 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1024074686 7:45812444-45812466 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1024075171 7:45814358-45814380 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1024648430 7:51386968-51386990 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1024648733 7:51388160-51388182 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1024648965 7:51389041-51389063 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025035440 7:55590364-55590386 CCTGGTCCTGCTGGGCCTCCAGG + Intergenic
1025052282 7:55741437-55741459 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025052677 7:55742985-55743007 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025053061 7:55744442-55744464 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025129961 7:56369992-56370014 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025130259 7:56371221-56371243 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025130579 7:56372519-56372541 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025130897 7:56373813-56373835 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025131216 7:56375108-56375130 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025131306 7:56375466-56375488 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025177833 7:56810910-56810932 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025177991 7:56811556-56811578 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025178256 7:56812629-56812651 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025178409 7:56813247-56813269 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025178688 7:56814371-56814393 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025178839 7:56814989-56815011 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025179126 7:56816161-56816183 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025179276 7:56816779-56816801 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025179581 7:56818047-56818069 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025179734 7:56818665-56818687 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025180031 7:56819885-56819907 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025180183 7:56820503-56820525 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025180502 7:56821867-56821889 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025180654 7:56822485-56822507 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025180949 7:56823714-56823736 CCGGGCCCAGCTCTTCCTCCCGG - Intronic
1025181376 7:56825456-56825478 CCGGGCCCAGCTCTTCCTCCCGG - Intronic
1025181528 7:56826074-56826096 CCAGGCCCAGCTCTTCCTCCCGG - Intronic
1025181972 7:56827916-56827938 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic
1025182709 7:56831704-56831726 CCAGGCCCAGCTCTTCCTCCCGG - Intergenic
1025689216 7:63745270-63745292 CCAGGTCCAGCTCTTCCTCCCGG + Intergenic
1025690096 7:63749701-63749723 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025690542 7:63751524-63751546 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025690990 7:63753347-63753369 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025691428 7:63755123-63755145 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025691865 7:63756946-63756968 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025692314 7:63758769-63758791 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025692760 7:63760592-63760614 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025693175 7:63762271-63762293 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1025693621 7:63764094-63764116 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1026045257 7:66902419-66902441 CCAGGCCCAGCTCTCCCTCCCGG + Intergenic
1026355174 7:69551164-69551186 GCCTGCCCTGCTCTGCTTCCAGG - Intergenic
1026674392 7:72416889-72416911 CCCTGCACTTCTCTGCCTCCTGG - Intronic
1027190671 7:75994112-75994134 CCCCGACCTGGGCTGCCTCTCGG + Intronic
1027202542 7:76072786-76072808 CCAGGCCCAGCTCTCCCTCCCGG - Intergenic
1027319422 7:77002765-77002787 CCAGGACCAGCCCTGCCTCAAGG - Intergenic
1027382327 7:77624240-77624262 CAGGGTCCTGCTCTGCCACCTGG - Intronic
1029742051 7:102496484-102496506 CCTGGACCTGCTCTTCCAGCTGG - Exonic
1029760040 7:102595649-102595671 CCTGGACCTGCTCTTCCAGCTGG - Exonic
1029899433 7:104023216-104023238 CCCGCACCTGTGCTGGCTCCTGG + Intergenic
1032051678 7:128654068-128654090 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1032698098 7:134355174-134355196 CCTGGCCCTGCTCAGCCACCAGG + Intergenic
1032858857 7:135858998-135859020 CCGGGCCCAGCTCTGCCTCGGGG + Intergenic
1034699478 7:153083870-153083892 CCAGCATCTGCTCTGCTTCCCGG + Intergenic
1034936454 7:155203559-155203581 CCCGCACCTGCACAGCCCCCGGG - Intergenic
1035061623 7:156073617-156073639 CCCCGCCCTGCTCTGACACCTGG - Intergenic
1035567660 8:652041-652063 CCCGCAAACGCTCTGCCTCCAGG - Intronic
1036294978 8:7528352-7528374 CCCGCATCTCCCCTGCCTCCAGG - Intergenic
1036327586 8:7792639-7792661 CCCGCATCTCCCCTGCCTCCAGG + Intergenic
1036710420 8:11074978-11075000 CCAGGCTCTGCTCTGCGTCCTGG - Intronic
1037116714 8:15236926-15236948 CCCGGACCTGCTCCCGCGCCTGG + Intronic
1038013600 8:23494448-23494470 CCCAGAGATGCCCTGCCTCCAGG - Intergenic
1038447263 8:27612741-27612763 CCCTCATCTCCTCTGCCTCCTGG + Intronic
1038566221 8:28622390-28622412 GCCGAGCCTGCGCTGCCTCCTGG - Intronic
1039372085 8:36995226-36995248 CAGGGACCTGCTATTCCTCCTGG - Intergenic
1040835354 8:51724873-51724895 CCCAGCCCAGCTCTTCCTCCAGG + Intronic
1040864342 8:52032955-52032977 CTCAGCCCTGCACTGCCTCCAGG - Intergenic
1043148076 8:76681099-76681121 TCCGGAGCTGCTCTGAGTCCGGG + Intergenic
1043878220 8:85510572-85510594 TCCTGACCAGCTCTTCCTCCTGG + Intergenic
1045023486 8:98064410-98064432 CCCTGCCCTCCTCTGCGTCCTGG + Exonic
1045057525 8:98382428-98382450 CTCTGACCTCCTCTGCCTTCTGG - Intergenic
1045502565 8:102754449-102754471 CCAGGAGCTGCTCAGCCACCAGG + Intergenic
1047000569 8:120568738-120568760 CCCGGACATACTCTGCCTCATGG + Intronic
1047407291 8:124596132-124596154 CCCGAACCTGCTCTTCCTCTGGG + Intronic
1047446347 8:124923652-124923674 CCTAGACCTGCTCCTCCTCCTGG + Intergenic
1048986742 8:139738813-139738835 CCAGGACCAGCTCTGCGCCCAGG - Intronic
1048988330 8:139747439-139747461 CCCACACCTGCTCTGACCCCTGG - Intronic
1049229072 8:141472799-141472821 CCCGCACCCGCTCTGCCGGCTGG - Intergenic
1049257883 8:141623579-141623601 CCAGGATTTGCTCTGCCTCCTGG - Intergenic
1049269665 8:141687602-141687624 CCCAGATCTGCTCTTCATCCAGG + Intergenic
1049285224 8:141771240-141771262 CCCGGGCCTGGTCTGTCTCAAGG + Intergenic
1049410243 8:142470787-142470809 CCCCTCCCTGCCCTGCCTCCAGG + Intronic
1049471627 8:142777421-142777443 CCCGCCCCTGCCCCGCCTCCTGG + Intronic
1049691913 8:143965224-143965246 CCTGGGTCTCCTCTGCCTCCAGG + Intronic
1050090955 9:2016288-2016310 CCCGAGCCTGCGCTGCCGCCAGG - Intronic
1053020892 9:34693232-34693254 CACGGCCCTGCTCTGCTCCCTGG + Intergenic
1054459620 9:65455691-65455713 CCCAGCTCTGCTCTGCCACCAGG + Intergenic
1055275636 9:74612341-74612363 CCCGGGCCAGCTCTGTCTTCAGG - Intronic
1056597965 9:88023188-88023210 CCCGCATCTGCTCAGCCTCTGGG - Intergenic
1057277228 9:93682327-93682349 CCCGGCCCTGCCCTGCCCCCCGG - Intergenic
1057524537 9:95786797-95786819 CCCGGGCCTGGTGTTCCTCCAGG + Intergenic
1057605184 9:96493916-96493938 CCAGGACTCGCGCTGCCTCCAGG + Intronic
1057911307 9:99022405-99022427 CCCAGACCTGCTTCTCCTCCTGG + Intronic
1058712298 9:107690777-107690799 CCCAAACCTGCTCTTCCTCTTGG - Intergenic
1059336029 9:113568969-113568991 CCAGGACATGCTCTTCCTTCTGG + Intronic
1059405072 9:114094320-114094342 CCCCATCCTACTCTGCCTCCAGG + Intronic
1059414680 9:114155600-114155622 CCCGGCCTTGCTCTGCCTCCGGG + Exonic
1059765756 9:117382309-117382331 CCCAAACCTGCTGTCCCTCCTGG - Intronic
1060503957 9:124183987-124184009 CCCAGTCTTGCCCTGCCTCCTGG - Intergenic
1061161255 9:128895661-128895683 CCTGGTCCTGCCCTGCCCCCAGG - Intronic
1061326183 9:129866130-129866152 CCAGGTCCAGCTCTGCCTGCAGG - Intronic
1061392801 9:130327205-130327227 GCAGTACCGGCTCTGCCTCCTGG + Intronic
1061649176 9:132032671-132032693 TCCTGACTGGCTCTGCCTCCTGG - Intronic
1061714223 9:132508944-132508966 CAGGGCCTTGCTCTGCCTCCTGG - Intronic
1062187570 9:135226907-135226929 CTCTGACCTGCTCTGTGTCCTGG + Intergenic
1062744352 9:138201929-138201951 CCCGTGACTGCACTGCCTCCTGG + Intergenic
1062754424 9:138279658-138279680 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1203578328 Un_KI270745v1:23818-23840 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1188007109 X:25022945-25022967 CCCGGAGCTCCCCTGCCCCCGGG - Intergenic
1188284799 X:28314492-28314514 CCTGGTCTAGCTCTGCCTCCTGG + Intergenic
1192162899 X:68801963-68801985 CCAGGACCAGCTCAGTCTCCCGG - Intergenic
1195614254 X:106900375-106900397 CCCTGCCCTGCTCTGCTTCCTGG + Exonic
1196896736 X:120344434-120344456 CCCTGACCTGTTGTGCTTCCCGG - Intergenic
1197175158 X:123477879-123477901 CCCGGTCCTGTCCTCCCTCCCGG - Intronic
1197892142 X:131278575-131278597 CCCGGACCTGCTCTGAGGCCGGG + Exonic
1198312679 X:135436880-135436902 CGCGGGCCAGCTCGGCCTCCAGG - Intergenic
1198919829 X:141713114-141713136 CCAGGACATGCTCTGTGTCCAGG - Intergenic
1198975110 X:142327575-142327597 CCCCATGCTGCTCTGCCTCCAGG - Intergenic
1199442195 X:147881014-147881036 CCTGGCCCAGCTCTGCCTCCTGG + Intergenic
1199600686 X:149539788-149539810 CCCCGCCCTGCTCCTCCTCCAGG + Intergenic
1200064595 X:153498366-153498388 CCCAGACTTCCCCTGCCTCCAGG - Intronic
1202380969 Y:24276455-24276477 CCGGGCCCAGCTCTTCCTCCCGG + Intergenic
1202489816 Y:25393671-25393693 CCGGGCCCAGCTCTTCCTCCCGG - Intergenic