ID: 985898256

View in Genome Browser
Species Human (GRCh38)
Location 5:2763543-2763565
Sequence TCTGGAGAGGAGGCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985898256_985898263 -4 Left 985898256 5:2763543-2763565 CCTCTCCTGGCCTCCTCTCCAGA No data
Right 985898263 5:2763562-2763584 CAGAGACGGCAACACCAGGCCGG No data
985898256_985898264 -1 Left 985898256 5:2763543-2763565 CCTCTCCTGGCCTCCTCTCCAGA No data
Right 985898264 5:2763565-2763587 AGACGGCAACACCAGGCCGGAGG No data
985898256_985898266 5 Left 985898256 5:2763543-2763565 CCTCTCCTGGCCTCCTCTCCAGA No data
Right 985898266 5:2763571-2763593 CAACACCAGGCCGGAGGCAAGGG No data
985898256_985898261 -8 Left 985898256 5:2763543-2763565 CCTCTCCTGGCCTCCTCTCCAGA No data
Right 985898261 5:2763558-2763580 TCTCCAGAGACGGCAACACCAGG No data
985898256_985898265 4 Left 985898256 5:2763543-2763565 CCTCTCCTGGCCTCCTCTCCAGA No data
Right 985898265 5:2763570-2763592 GCAACACCAGGCCGGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985898256 Original CRISPR TCTGGAGAGGAGGCCAGGAG AGG (reversed) Intergenic
No off target data available for this crispr