ID: 985901683

View in Genome Browser
Species Human (GRCh38)
Location 5:2800651-2800673
Sequence GTGGGGAAACGGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985901672_985901683 18 Left 985901672 5:2800610-2800632 CCCTGTTTGCCCTCTACTCAGCC No data
Right 985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG No data
985901676_985901683 -3 Left 985901676 5:2800631-2800653 CCACGAGAATACCTAATGCAGTG No data
Right 985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG No data
985901675_985901683 8 Left 985901675 5:2800620-2800642 CCTCTACTCAGCCACGAGAATAC No data
Right 985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG No data
985901673_985901683 17 Left 985901673 5:2800611-2800633 CCTGTTTGCCCTCTACTCAGCCA No data
Right 985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG No data
985901674_985901683 9 Left 985901674 5:2800619-2800641 CCCTCTACTCAGCCACGAGAATA No data
Right 985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985901683 Original CRISPR GTGGGGAAACGGAAGCAGGA AGG Intergenic
No off target data available for this crispr