ID: 985903295

View in Genome Browser
Species Human (GRCh38)
Location 5:2813784-2813806
Sequence GGTACAGAGGGACCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985903295_985903307 11 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data
985903295_985903300 -7 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903300 5:2813800-2813822 CTGTACCTGGAGTGCTGCCAGGG No data
985903295_985903299 -8 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903299 5:2813799-2813821 TCTGTACCTGGAGTGCTGCCAGG No data
985903295_985903302 -3 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903295_985903301 -6 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903301 5:2813801-2813823 TGTACCTGGAGTGCTGCCAGGGG No data
985903295_985903304 1 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903304 5:2813808-2813830 GGAGTGCTGCCAGGGGAGGTAGG No data
985903295_985903308 12 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903308 5:2813819-2813841 AGGGGAGGTAGGAGCAGGCTGGG No data
985903295_985903309 27 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903309 5:2813834-2813856 AGGCTGGGATCCTCTGTCCAAGG No data
985903295_985903305 7 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985903295 Original CRISPR GGTACAGAGGGACCCCAAGC AGG (reversed) Intergenic
No off target data available for this crispr