ID: 985903302

View in Genome Browser
Species Human (GRCh38)
Location 5:2813804-2813826
Sequence ACCTGGAGTGCTGCCAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985903290_985903302 11 Left 985903290 5:2813770-2813792 CCTCAGAGGCTGACCCTGCTTGG No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903295_985903302 -3 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903288_985903302 17 Left 985903288 5:2813764-2813786 CCCTGGCCTCAGAGGCTGACCCT No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903286_985903302 26 Left 985903286 5:2813755-2813777 CCACATTGGCCCTGGCCTCAGAG No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903285_985903302 27 Left 985903285 5:2813754-2813776 CCCACATTGGCCCTGGCCTCAGA No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903283_985903302 29 Left 985903283 5:2813752-2813774 CCCCCACATTGGCCCTGGCCTCA No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903294_985903302 -2 Left 985903294 5:2813783-2813805 CCCTGCTTGGGGTCCCTCTGTAC No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903284_985903302 28 Left 985903284 5:2813753-2813775 CCCCACATTGGCCCTGGCCTCAG No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data
985903289_985903302 16 Left 985903289 5:2813765-2813787 CCTGGCCTCAGAGGCTGACCCTG No data
Right 985903302 5:2813804-2813826 ACCTGGAGTGCTGCCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985903302 Original CRISPR ACCTGGAGTGCTGCCAGGGG AGG Intergenic
No off target data available for this crispr