ID: 985903304

View in Genome Browser
Species Human (GRCh38)
Location 5:2813808-2813830
Sequence GGAGTGCTGCCAGGGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985903294_985903304 2 Left 985903294 5:2813783-2813805 CCCTGCTTGGGGTCCCTCTGTAC No data
Right 985903304 5:2813808-2813830 GGAGTGCTGCCAGGGGAGGTAGG No data
985903286_985903304 30 Left 985903286 5:2813755-2813777 CCACATTGGCCCTGGCCTCAGAG No data
Right 985903304 5:2813808-2813830 GGAGTGCTGCCAGGGGAGGTAGG No data
985903295_985903304 1 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903304 5:2813808-2813830 GGAGTGCTGCCAGGGGAGGTAGG No data
985903290_985903304 15 Left 985903290 5:2813770-2813792 CCTCAGAGGCTGACCCTGCTTGG No data
Right 985903304 5:2813808-2813830 GGAGTGCTGCCAGGGGAGGTAGG No data
985903288_985903304 21 Left 985903288 5:2813764-2813786 CCCTGGCCTCAGAGGCTGACCCT No data
Right 985903304 5:2813808-2813830 GGAGTGCTGCCAGGGGAGGTAGG No data
985903289_985903304 20 Left 985903289 5:2813765-2813787 CCTGGCCTCAGAGGCTGACCCTG No data
Right 985903304 5:2813808-2813830 GGAGTGCTGCCAGGGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985903304 Original CRISPR GGAGTGCTGCCAGGGGAGGT AGG Intergenic
No off target data available for this crispr