ID: 985903305

View in Genome Browser
Species Human (GRCh38)
Location 5:2813814-2813836
Sequence CTGCCAGGGGAGGTAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985903289_985903305 26 Left 985903289 5:2813765-2813787 CCTGGCCTCAGAGGCTGACCCTG No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data
985903295_985903305 7 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data
985903298_985903305 -6 Left 985903298 5:2813797-2813819 CCTCTGTACCTGGAGTGCTGCCA No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data
985903290_985903305 21 Left 985903290 5:2813770-2813792 CCTCAGAGGCTGACCCTGCTTGG No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data
985903297_985903305 -5 Left 985903297 5:2813796-2813818 CCCTCTGTACCTGGAGTGCTGCC No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data
985903294_985903305 8 Left 985903294 5:2813783-2813805 CCCTGCTTGGGGTCCCTCTGTAC No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data
985903288_985903305 27 Left 985903288 5:2813764-2813786 CCCTGGCCTCAGAGGCTGACCCT No data
Right 985903305 5:2813814-2813836 CTGCCAGGGGAGGTAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985903305 Original CRISPR CTGCCAGGGGAGGTAGGAGC AGG Intergenic
No off target data available for this crispr