ID: 985903307

View in Genome Browser
Species Human (GRCh38)
Location 5:2813818-2813840
Sequence CAGGGGAGGTAGGAGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985903298_985903307 -2 Left 985903298 5:2813797-2813819 CCTCTGTACCTGGAGTGCTGCCA No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data
985903303_985903307 -10 Left 985903303 5:2813805-2813827 CCTGGAGTGCTGCCAGGGGAGGT No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data
985903289_985903307 30 Left 985903289 5:2813765-2813787 CCTGGCCTCAGAGGCTGACCCTG No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data
985903290_985903307 25 Left 985903290 5:2813770-2813792 CCTCAGAGGCTGACCCTGCTTGG No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data
985903297_985903307 -1 Left 985903297 5:2813796-2813818 CCCTCTGTACCTGGAGTGCTGCC No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data
985903294_985903307 12 Left 985903294 5:2813783-2813805 CCCTGCTTGGGGTCCCTCTGTAC No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data
985903295_985903307 11 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985903307 Original CRISPR CAGGGGAGGTAGGAGCAGGC TGG Intergenic
No off target data available for this crispr