ID: 985903309

View in Genome Browser
Species Human (GRCh38)
Location 5:2813834-2813856
Sequence AGGCTGGGATCCTCTGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985903306_985903309 -6 Left 985903306 5:2813817-2813839 CCAGGGGAGGTAGGAGCAGGCTG No data
Right 985903309 5:2813834-2813856 AGGCTGGGATCCTCTGTCCAAGG No data
985903297_985903309 15 Left 985903297 5:2813796-2813818 CCCTCTGTACCTGGAGTGCTGCC No data
Right 985903309 5:2813834-2813856 AGGCTGGGATCCTCTGTCCAAGG No data
985903294_985903309 28 Left 985903294 5:2813783-2813805 CCCTGCTTGGGGTCCCTCTGTAC No data
Right 985903309 5:2813834-2813856 AGGCTGGGATCCTCTGTCCAAGG No data
985903303_985903309 6 Left 985903303 5:2813805-2813827 CCTGGAGTGCTGCCAGGGGAGGT No data
Right 985903309 5:2813834-2813856 AGGCTGGGATCCTCTGTCCAAGG No data
985903298_985903309 14 Left 985903298 5:2813797-2813819 CCTCTGTACCTGGAGTGCTGCCA No data
Right 985903309 5:2813834-2813856 AGGCTGGGATCCTCTGTCCAAGG No data
985903295_985903309 27 Left 985903295 5:2813784-2813806 CCTGCTTGGGGTCCCTCTGTACC No data
Right 985903309 5:2813834-2813856 AGGCTGGGATCCTCTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985903309 Original CRISPR AGGCTGGGATCCTCTGTCCA AGG Intergenic
No off target data available for this crispr