ID: 985907522 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:2852601-2852623 |
| Sequence | GAGCAGAGGCAGAAAGAGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985907522_985907525 | -5 | Left | 985907522 | 5:2852601-2852623 | CCTTGCTCTTTCTGCCTCTGCTC | No data | ||
| Right | 985907525 | 5:2852619-2852641 | TGCTCATGGCCAACAACCCTTGG | No data | ||||
| 985907522_985907527 | 5 | Left | 985907522 | 5:2852601-2852623 | CCTTGCTCTTTCTGCCTCTGCTC | No data | ||
| Right | 985907527 | 5:2852629-2852651 | CAACAACCCTTGGCCTTCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985907522 | Original CRISPR | GAGCAGAGGCAGAAAGAGCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||