ID: 985907522

View in Genome Browser
Species Human (GRCh38)
Location 5:2852601-2852623
Sequence GAGCAGAGGCAGAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985907522_985907525 -5 Left 985907522 5:2852601-2852623 CCTTGCTCTTTCTGCCTCTGCTC No data
Right 985907525 5:2852619-2852641 TGCTCATGGCCAACAACCCTTGG No data
985907522_985907527 5 Left 985907522 5:2852601-2852623 CCTTGCTCTTTCTGCCTCTGCTC No data
Right 985907527 5:2852629-2852651 CAACAACCCTTGGCCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985907522 Original CRISPR GAGCAGAGGCAGAAAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr