ID: 985912988

View in Genome Browser
Species Human (GRCh38)
Location 5:2897531-2897553
Sequence CGCTGTGGCTGCTGAGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985912977_985912988 16 Left 985912977 5:2897492-2897514 CCCAGTGCCTCCAGCAACAGTGG No data
Right 985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG No data
985912974_985912988 23 Left 985912974 5:2897485-2897507 CCCTCCTCCCAGTGCCTCCAGCA No data
Right 985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG No data
985912975_985912988 22 Left 985912975 5:2897486-2897508 CCTCCTCCCAGTGCCTCCAGCAA No data
Right 985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG No data
985912976_985912988 19 Left 985912976 5:2897489-2897511 CCTCCCAGTGCCTCCAGCAACAG No data
Right 985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG No data
985912979_985912988 15 Left 985912979 5:2897493-2897515 CCAGTGCCTCCAGCAACAGTGGG No data
Right 985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG No data
985912981_985912988 9 Left 985912981 5:2897499-2897521 CCTCCAGCAACAGTGGGATTTTC No data
Right 985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG No data
985912982_985912988 6 Left 985912982 5:2897502-2897524 CCAGCAACAGTGGGATTTTCCTG No data
Right 985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985912988 Original CRISPR CGCTGTGGCTGCTGAGTACA CGG Intergenic
No off target data available for this crispr