ID: 985916491

View in Genome Browser
Species Human (GRCh38)
Location 5:2922805-2922827
Sequence CTGCAATAAGCAGTGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985916491_985916495 -10 Left 985916491 5:2922805-2922827 CCCTCCAGCACTGCTTATTGCAG No data
Right 985916495 5:2922818-2922840 CTTATTGCAGTGATACCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985916491 Original CRISPR CTGCAATAAGCAGTGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr