ID: 985918419

View in Genome Browser
Species Human (GRCh38)
Location 5:2946228-2946250
Sequence TTCCCAGGAAGCTCCGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985918414_985918419 -10 Left 985918414 5:2946215-2946237 CCCCCTTCCTTCATTCCCAGGAA No data
Right 985918419 5:2946228-2946250 TTCCCAGGAAGCTCCGATAAAGG No data
985918411_985918419 14 Left 985918411 5:2946191-2946213 CCAATGATAAATTGGCTGTGCCA No data
Right 985918419 5:2946228-2946250 TTCCCAGGAAGCTCCGATAAAGG No data
985918412_985918419 -6 Left 985918412 5:2946211-2946233 CCAGCCCCCTTCCTTCATTCCCA No data
Right 985918419 5:2946228-2946250 TTCCCAGGAAGCTCCGATAAAGG No data
985918409_985918419 26 Left 985918409 5:2946179-2946201 CCGCTGTTGGCACCAATGATAAA No data
Right 985918419 5:2946228-2946250 TTCCCAGGAAGCTCCGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985918419 Original CRISPR TTCCCAGGAAGCTCCGATAA AGG Intergenic
No off target data available for this crispr