ID: 985922369

View in Genome Browser
Species Human (GRCh38)
Location 5:2987565-2987587
Sequence TCTTCTATTCAGGACCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985922369_985922371 20 Left 985922369 5:2987565-2987587 CCATTCAGGTCCTGAATAGAAGA No data
Right 985922371 5:2987608-2987630 CTATCTGACTACCTTTGAGCTGG No data
985922369_985922372 21 Left 985922369 5:2987565-2987587 CCATTCAGGTCCTGAATAGAAGA No data
Right 985922372 5:2987609-2987631 TATCTGACTACCTTTGAGCTGGG No data
985922369_985922373 22 Left 985922369 5:2987565-2987587 CCATTCAGGTCCTGAATAGAAGA No data
Right 985922373 5:2987610-2987632 ATCTGACTACCTTTGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985922369 Original CRISPR TCTTCTATTCAGGACCTGAA TGG (reversed) Intergenic
No off target data available for this crispr