ID: 985924443

View in Genome Browser
Species Human (GRCh38)
Location 5:3004850-3004872
Sequence GCATTTGCACAGGTGGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985924443_985924453 28 Left 985924443 5:3004850-3004872 CCACAGTCCACCTGTGCAAATGC No data
Right 985924453 5:3004901-3004923 CAGCTTCTCCCTTCTAGTCCAGG No data
985924443_985924454 29 Left 985924443 5:3004850-3004872 CCACAGTCCACCTGTGCAAATGC No data
Right 985924454 5:3004902-3004924 AGCTTCTCCCTTCTAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985924443 Original CRISPR GCATTTGCACAGGTGGACTG TGG (reversed) Intergenic
No off target data available for this crispr