ID: 985924453

View in Genome Browser
Species Human (GRCh38)
Location 5:3004901-3004923
Sequence CAGCTTCTCCCTTCTAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985924446_985924453 18 Left 985924446 5:3004860-3004882 CCTGTGCAAATGCTCAGGCTCCT No data
Right 985924453 5:3004901-3004923 CAGCTTCTCCCTTCTAGTCCAGG No data
985924443_985924453 28 Left 985924443 5:3004850-3004872 CCACAGTCCACCTGTGCAAATGC No data
Right 985924453 5:3004901-3004923 CAGCTTCTCCCTTCTAGTCCAGG No data
985924448_985924453 -6 Left 985924448 5:3004884-3004906 CCAGCACCCCACCAGCTCAGCTT No data
Right 985924453 5:3004901-3004923 CAGCTTCTCCCTTCTAGTCCAGG No data
985924445_985924453 21 Left 985924445 5:3004857-3004879 CCACCTGTGCAAATGCTCAGGCT No data
Right 985924453 5:3004901-3004923 CAGCTTCTCCCTTCTAGTCCAGG No data
985924447_985924453 -2 Left 985924447 5:3004880-3004902 CCTGCCAGCACCCCACCAGCTCA No data
Right 985924453 5:3004901-3004923 CAGCTTCTCCCTTCTAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985924453 Original CRISPR CAGCTTCTCCCTTCTAGTCC AGG Intergenic
No off target data available for this crispr