ID: 985924454

View in Genome Browser
Species Human (GRCh38)
Location 5:3004902-3004924
Sequence AGCTTCTCCCTTCTAGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985924445_985924454 22 Left 985924445 5:3004857-3004879 CCACCTGTGCAAATGCTCAGGCT No data
Right 985924454 5:3004902-3004924 AGCTTCTCCCTTCTAGTCCAGGG No data
985924448_985924454 -5 Left 985924448 5:3004884-3004906 CCAGCACCCCACCAGCTCAGCTT No data
Right 985924454 5:3004902-3004924 AGCTTCTCCCTTCTAGTCCAGGG No data
985924443_985924454 29 Left 985924443 5:3004850-3004872 CCACAGTCCACCTGTGCAAATGC No data
Right 985924454 5:3004902-3004924 AGCTTCTCCCTTCTAGTCCAGGG No data
985924446_985924454 19 Left 985924446 5:3004860-3004882 CCTGTGCAAATGCTCAGGCTCCT No data
Right 985924454 5:3004902-3004924 AGCTTCTCCCTTCTAGTCCAGGG No data
985924447_985924454 -1 Left 985924447 5:3004880-3004902 CCTGCCAGCACCCCACCAGCTCA No data
Right 985924454 5:3004902-3004924 AGCTTCTCCCTTCTAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985924454 Original CRISPR AGCTTCTCCCTTCTAGTCCA GGG Intergenic
No off target data available for this crispr