ID: 985926696

View in Genome Browser
Species Human (GRCh38)
Location 5:3024827-3024849
Sequence CCTTGAAGGGAGAGGACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985926696_985926705 20 Left 985926696 5:3024827-3024849 CCAGCCGTCCTCTCCCTTCAAGG No data
Right 985926705 5:3024870-3024892 AGCGAGATCATCTCCCTATAAGG No data
985926696_985926706 21 Left 985926696 5:3024827-3024849 CCAGCCGTCCTCTCCCTTCAAGG No data
Right 985926706 5:3024871-3024893 GCGAGATCATCTCCCTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985926696 Original CRISPR CCTTGAAGGGAGAGGACGGC TGG (reversed) Intergenic
No off target data available for this crispr