ID: 985927547

View in Genome Browser
Species Human (GRCh38)
Location 5:3029658-3029680
Sequence CTCCCAGGGGGAACAGTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927547_985927562 19 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927562 5:3029700-3029722 AGGTGGGCGTCAAAGGCGAGGGG No data
985927547_985927554 -1 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927554 5:3029680-3029702 GGACTGTGCAGGTGTCCACCAGG No data
985927547_985927556 3 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927556 5:3029684-3029706 TGTGCAGGTGTCCACCAGGTGGG No data
985927547_985927555 2 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927555 5:3029683-3029705 CTGTGCAGGTGTCCACCAGGTGG No data
985927547_985927563 22 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data
985927547_985927560 17 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927560 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
985927547_985927557 12 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927557 5:3029693-3029715 GTCCACCAGGTGGGCGTCAAAGG No data
985927547_985927564 26 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927564 5:3029707-3029729 CGTCAAAGGCGAGGGGCGGCTGG No data
985927547_985927561 18 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927547 Original CRISPR CTCCCAGGGGGAACAGTTCT CGG (reversed) Intergenic