ID: 985927550

View in Genome Browser
Species Human (GRCh38)
Location 5:3029670-3029692
Sequence ACCTGCACAGTCCTCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927550_985927567 27 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927567 5:3029720-3029742 GGGCGGCTGGTGTGGGAGTGTGG No data
985927550_985927561 6 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data
985927550_985927560 5 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927560 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
985927550_985927563 10 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data
985927550_985927564 14 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927564 5:3029707-3029729 CGTCAAAGGCGAGGGGCGGCTGG No data
985927550_985927565 19 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927550_985927556 -9 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927556 5:3029684-3029706 TGTGCAGGTGTCCACCAGGTGGG No data
985927550_985927562 7 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927562 5:3029700-3029722 AGGTGGGCGTCAAAGGCGAGGGG No data
985927550_985927566 20 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927550_985927555 -10 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927555 5:3029683-3029705 CTGTGCAGGTGTCCACCAGGTGG No data
985927550_985927557 0 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927557 5:3029693-3029715 GTCCACCAGGTGGGCGTCAAAGG No data
985927550_985927568 30 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927568 5:3029723-3029745 CGGCTGGTGTGGGAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927550 Original CRISPR ACCTGCACAGTCCTCCCAGG GGG (reversed) Intergenic